Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2508
Contig Information
Length 1306 bp
Tissue Root of dessiccated seed
Clones 7 Clones [Download: CSV  ,  FASTA ]
whrd10g05    whrd1o09    whrd6m20    whrd8m08    rwhrd10g05    rwhrd1o09    rwhrd8m08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0739600 [Oryza sativa (japonica cultivar-group)] >gi|46390562|dbj|BAD16048.1| putative pyruvate dehydrogenase E1 alpha subunit [Oryza sativa Japonica Group] >gi|113537599|dbj|BAF09982.1| Os02g0739600 [Oryza sativa (japonica cultivar-group)] >gi|125583627|gb|EAZ24558.1| hypothetical protein OsJ_008041 [Oryza sativa (japonica cultivar-group)] >gi|215704394|dbj|BAG93828.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1714
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2508
ATCGTCGACCCGCCCTCCCGCGACGTCGCCACCACCCCCGCCGAGCTCGTCGCCTTCTTCCACGACATGTCCCTCATGCGCCGCATGGAGATCGCCGCCG
ACTCGCTCTACAAGGCCAAGCTCATCCGCGGCTTCTGCCACCTCTACGACGGCCAGGAGGCCGTCTGCGCCGGCATGGAGGCCGCCATCACCCGCAAGGA
CTCCATCATCACCGCCTACCGCGACCACTGCATCTTCCTCTCCCGCGGCGGCGACCTCGTCACCGCCTTCGCCGAGCTCATGGGCCGCCAGGTCGGCTGC
TCCCGCGGCAAGGGCGGATCCATGCATTTTTACAAGAAGGACGCCAACTTCTACGGGGGCCACGGGATCGTCGGCGCCCAGGTGCCCCTCGGCTGCGGCC
TCGCCTTCGCGCAGAAGTACAGGAAGGAGGACACCGTCTCCTTCTCGCTCTACGGCGATGGCGCCGCCAACCAGGGCCAGCTCTTTGAGGCGCTCAACAT
CTCGGCCCTCTGGAAGCTGCCCGCCATACTGGTCTGCGAGAACAACCATTATGGGATGGGAACGGCGGAGTGGAGGGCGGCCAAGAGCCCCTCCTACTAC
AAGCGTGGTGACTATGTGCCTGGATTGAAGGTGGACGGAATGGATGTTCTTGCTGTGAAGCAGGCATGCAAATTTGCGAAGGAGCATGCCATTGCAAATG
GCCCAATTGTTCTTGAAATGGACACGTATAGGTACCACGGCCACTCTATGTCCGATCCAGGAAGCACTTACCGCACCAGGGATGAGATCTCGGGTGTAAG
ACAGGAGCGTGATCCAATTGAAAGGGTTAGGAAGTTGCTCTTGGCTCATGACCTAGCAACCCCTGCTGAGCTCAAGGACATGGAGAAAGAAATTAGGAAA
GAAGTCGACGCTGCCATTGCTAAAGCCAAGGAAAGTCCTATGCCTGATGCTTCTGAGCTCTTTACAAATGTCTACGTTAAGGGTTTCGGCGTTGAGTCAT
TTGGCGCAGACAGAAAGGAGTTGAGAGCTACACTCCCATAGGTCACCAACCTGAAGATGAAGATGAGTACTCTTCTAACACGTTGAGATATCGAGGAGAA
ATAAGCATCAGTGAACAAACCCTTGGGTGTTGCTGGCAGTTTTTGTTGCAAAACGAACCTGTATAGAGATGTGATGTCAGGGGAATTCGTTCCTTATTTG
TTTTGTTTTCCTTTTTTTTTCTTCTGCAATTCAGTTTAACTGCTGCTGGCTGGCTTCTTATTGAAGCTAGTGATTTGGCCTCCATAATCGCTTCTGTTCG
CAAAAT
page-top