Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2505
Contig Information
Length 729 bp
Tissue Root of dessiccated seed
Clones 7 Clones [Download: CSV  ,  FASTA ]
whrd10c11    whrd10f22    whrd5m04    whrd11a21    whrd11e09    whrd12a13    whrd12i16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38200 [Oryza sativa Indica Group]
Score 1095
Evalue 8.84397e-118
Total Hit Count 110
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2505
ATTTCTGAGAGCTCAGCACATCTTCAGGTTTTCCTTCTACCAAAGCCATGGGTTCAGGTCTCTTCAAGCCTAGTGTTCATCCGGACCTCCGTGATGTTTT
CTCTAAGATGTCTTTGGGTGACAAGATTGGCTTTCTATTCATTCATGCATTTGACAAGAGAAACTTGTGGCACAAGATGCCTGTTCTGATCGGTTTACTC
TACCTAAACACCCGCCGGACCCTCCTCGAGAAATACAACCTGCTAGCTGTTGGGAGTTCTCATGGTACTCTGTTTGACCCCAAGGAGTTCCCGTACCGCA
CCGGAGATGGCAAGTACAACGACCCCCATAATGCTGAGGCTGGTAGCCAATACACCTTTTTTGGGAGAAACATGAAACCAGTTGATCAACAGGATGAGTT
GATGAGCCCAGATCCATTTGTTGTGGCGACAAAGCTGTTAGCCAGGCGAGAATACAAGGACACAGGGAAGCAGTTCAATATACTAGCAGCTGCATGGATA
CAGTTCATGGTTCATGACTGGATGGATCATATGGAGGATACCAAACAGATTGAAATCACTGCTCCAAAAGAAGTGGCCAATGAGTGCCCCCTCAAATCGT
TCAAGTTCTACGCCACAAAAGAACAGCCTACAAATTCTGATGGAATAAAGACTGGTTACAATAATGTCCGCACAGCTTGGTGGGATGGGAGTGCAGTATA
TGGTAATAATGAGAAACAGGCAGAAAAGA
page-top