Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2485
Contig Information
Length 880 bp
Tissue Root of dessiccated seed
Clones 7 Clones [Download: CSV  ,  FASTA ]
whrd10c09    whrd7g16    whrd7h03    rwhrd2o14    rwhrd7g16    rwhrd7h03    rwhrd19h08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Alanine aminotransferase 2; Short=ALAAT-2; AltName: Full=Glutamic--pyruvic transaminase 2; AltName: Full=Glutamate pyruvate transaminase 2; Short=GPT; AltName: Full=Glutamic--alanine transaminase 2 >gi|469148|emb|CAA81231.1| alanine aminotransferase [Hordeum vulgare subsp. vulgare]
Score 1096
Evalue 9.50323e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2485
AGGCATCAGACTGGTAATCTGATATAGTATCACACACACAAGCCATGGATTTGCTTTATTTTGTCTCATCTACAGGATACTGCTGTCAACGCGGGCAAAA
ACGCCTAGGGAAAATCCATGAGGCTTGCATGTAATCCCACACATGTTACACCAGTTTAGTCACGGTACTCTGCCATGAACGTCTCATGGAACACCGTGAA
GCGGGAGATGATTGCCGGGATCTTCTCCTCCTGCGGAAGGATCGTGCACCTGAAGTGCCATGTGCCAGGAACCTGGCCAAATCCAGATCCAGGGACAACG
ACGATTCCTGTCGACTCAAGGAGACGAAGAGCATAGAATGCATCAGGTGCTTTGTTAGCAGCTTTAGCAGCCTCAATCGCCTTCTGTGGCAGACAGATTT
GAGGGAACAGGTACATTGCTCCTTCAGCCTTGTTGCAAGTAATTCCCTCAAGTTTACTGAATGCAACCTCCAATGCCTTCGCACGACGAGCTAACGATGC
AAGGATTCCATCTTTCTCTGCCTTGTATGAAGCATATGATTCATCACTAGCCTTTGGTGGGTTCATGACAAGACTAGCAAGGATCTGGCCGGTGATATTG
GAACATAGGTTCACTGATGCTATTTTGTAGATCTGCTCTCTTACTGGAGCACTGAAGCCAGTAATCTCCATGTAACCACCTCTTTTACCACACTCACCAT
AATATCCCTTAGAAACAGATTGATATGATACTAGAGGGAGATCCTCCTCGCCGTATCCCAAGGATCTCACTATCTTCTTGAAAGAGTGGAATTTCTTGTT
GTCAGCGTAGATGTTCTCTTGGTATACCTCGTCAGCCAGAAGAACAAGACCCTCATTTTTGCAGAACTTCACTATGTCAT
page-top