Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2471
Contig Information
Length 1054 bp
Tissue Root of dessiccated seed
Clones 6 Clones [Download: CSV  ,  FASTA ]
whrd3m06    whrd4c21    whrd15h08    rwhrd3m06    rwhrd4c21    rwhrd15h08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1094
Evalue 2.18482e-117
Total Hit Count 495
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2471
TTTTTTTTTTAAACTAAATATTTAGTTTTAAACTCATAACCTCCATCCAGAAAGTAACACGAACAAAATAAGATAACTGAACGCTGGCTAGGAATGTCGA
CAGAAGTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAGGTGGCACATATATCATCTTCTAGATATGAAGCAGCAAAATAGCG
ACTTCTATTTTCTACTCAGCAGCAGCAACCTCCTCCGCTCCAGGAATCACCTCATCTCCATCAGCAGGCCTGTCAAGCTTCACACCAACATCCTCCTTGT
AGTCACCGTGCACCTCCATGAGCTTCCCCAGGTCAAACTTGGGGGCCTTCAGGATCTTCACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCTTGA
GGTGGCCTTCTCAATCTCCTTTCCAATCACCTCAGGGATGAACTTGTTCACAAGCTCCTTCAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACC
ATCTTGCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCACCTGGTTTGGGCGTCTCTTCGTGAAGCCAATGGTGAACATGCGGA
GCATGTAGTTGTCAGTGGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCACTTCCTCACAAGAGACCTGAGCTTGTCAGTGGTGAAGTCCATGCC
CCAGAAGTTTGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCTTCCTGTAGGCCTGGTCCTCATCGTTCTGAAGATCAGCTAGAGAT
ACTTCGAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGCGTCCTGGACACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCG
GCGCCTTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTCTTGCTTCCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGC
CATGGTTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTGAGCG
page-top