Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig35
Contig Information
Length 583 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl7f21    rwhfl7f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.3 >gi|125524425|gb|EAY72539.1| hypothetical protein OsI_00404 [Oryza sativa Indica Group]
Score 294
Evalue 3.99542e-25
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig35
acCCATCCTCCTCTGCCTCCCAGCGAAACACCACACCTCTCCTCGTCGAAGCAGCAGCAGCAGCGGCATCCATGGCCCCCAAGGCGGAGAAGAAGCCGGT
GGCGGAGAAGGCCGAGAAGACGACGACAGCGAAGAAGACCAAGGCCGAGAAGCGGCCGCCGGCTTCCAAGGAGGGCGGTGAGAAGAAGGGGAAGAAGAAG
TCCAAGAAGAGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTGCACCCGGACATCGGCATCTCCTCCAAGGCCATGTCCATCATGA
ACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGCGAGTCCGCCAAGCTGGCGCGCTACAACAAGAAGCCCACCATCACGTCCCGAGGTGAAAGGGC
GTGTAGAGATGTGCCTTTCTGCTCGAAGCCTGAGACAAGTTAGAGTTTGCTTATCTGCTGCTTGTTCACAAGATTCACAGAATCGTTGCAATAAGAATGT
ACTGCTAATTGCTCCCTGTGTTGCTGTATGTCAATGTTTGGGGGCAAGAATTGTTATCTGACGAcatgatgcttttttgtgta
page-top