Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2402
Contig Information
Length 883 bp
Tissue Root of dessiccated seed
Clones 6 Clones [Download: CSV  ,  FASTA ]
whrd10d19    whrd10n22    whrd16n04    rwhrd10d19    rwhrd10n22    rwhrd16n04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cyclophilin [Triticum aestivum] >gi|32401384|gb|AAP80861.1| cyclophilin [Triticum aestivum]
Score 863
Evalue 1.00283e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2402
TTTTTTTTTTGATGCCTTCAAAGTTGCCAGCCAGATCACGGGTAGGCAAGTCATTATACTTTCTTATAGCAAGAGAATCCTTGGTCGTCTGAATTTCACA
CGAAAGTACACGAAAACAAAAAACAGACCGGCTAGTAACGGTTCTACAACGAAAACTAGTCACCGTAGCTTCCACCAGAGCCCATTTCAGGTCTCATCAC
AGCGGCACTTCACCGCTGTCGGCAATGACAACCTTGCTCTTTGGCGTCCCGTTCTGCTTGCCCTCGGCCTCAACCTTGTAGACCACGTCCATTCCAGACA
ACACCTTGCCGAACACGACGTGCTTGCCGTCCAACCAGCTCGTGGTTACAGTGGTGATGAAGAACTGGGATCCATTGGTATCTCTCCCAGCATTGGCCAT
GGAAAGGTAGCCTGGTCCAGTGTGCTTGAGCTTGAAGTTCTCATCGGCGAACTTTGTGCCATAGATTGATTCACCGCCCCTTCCATCGCCAAGAGTGAAG
TCCCCTCCTTGGATCATGAAGCTGGGGATAATTCTGTGGAACGAACTCCCCTTGTAGTGGAGAGGTTTGCCGCTGTTGCCCATGCCTTTCTCACCTGTGC
AGAGTGCTCTGAAGTTCTCTGCGGTTTTAGGAACAGCCTTGCCGAAAAGTCCCATGACAACCCGACCTGCGGGCTTGCCGTCGATCTCGATGTCGAAGTA
GACCTTGTGCGTCACCTCAGACAGGTTGGATTTCTTGCCCTGGGCGAGCACCAGGGTGGCGGCGACGAGCGCCAGCCACAGGCACAGGTGCGCCGGGGCC
CTCGCCGCCGCGCTCCTCCTCCACGCCCTCATCGCCATCTTGGATCGTATCGCCGCGGATGAGAGAGAGAGGGAGAGCAGATC
page-top