Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2389
Contig Information
Length 586 bp
Tissue Root of dessiccated seed
Clones 6 Clones [Download: CSV  ,  FASTA ]
whrd10c14    whrd10d01    whrd10d02    rwhrd10c14    rwhrd10d01    rwhrd10d02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 548
Evalue 1.42959e-54
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2389
ATGCATGGTACGGGCAAATGCTAGCGAAGGGAGAACTCAGGCTCGATATGGGTGACAGTATCAAGGGAAAGGGGATGATTCAGGGTATTTCTGCTGTTGG
TGCGTTTTTTGAGCTGCTCAGTCAACCCAGCTTAAGTGTGCTACACCCAGAGGAAAACAAGCAAGTTGCTCCTGCTGAACTGTGCCCGATTCTGAAGAGG
CTTTATAGAATTCTGATAAAAAGGGAGCTCCCAGTGGGAGACATCCTCCAAGCCCTGAGGGACGAAACCATGAACGACCCTCGTGAGAGGATCGAGATGG
CGCAGAGCCACACATTCTACCGCCCGTCTCTCCTTGGGAAGCCGTGACCTCGGTTGCCCCGTGTACATGATTAGAATGTAAACAAAAGGCTTGGATTAGC
TCCAACCCTGTCATGCTTCACATCATTATCGGTTGAGCAAAGGCGTCTCCGGGTTTCTGCTGGCTTCTGTGTTTGGATCCCAGGCCCCAGCGGCCATAGT
TTGTGGGGGTCGTTAGACTGTCATGTTGTACAAGAGAGTATTGATCGAGTGAATAATATGTTGCTACTTGGACAATAAAAAAAAAA
page-top