Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2369
Contig Information
Length 909 bp
Tissue Root of dessiccated seed
Clones 6 Clones [Download: CSV  ,  FASTA ]
whrd10a24    whrd4f13    whrd7m09    rwhrd10a24    rwhrd4f13    rwhrd7m09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ABA-induced protein [Cynodon dactylon]
Score 856
Evalue 6.8658e-90
Total Hit Count 133
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2369
CATCGCATTCGCAACCGCTCTCCGTTTATATCCCCGGCCTCACCACCTTGGCATCACTACTTCTCCCTCCTCGCAACCTTTCCCCCCGTCTCGTTGGAAT
CCATGGCGTCCAAGTCCGCGGTCACCGCAGGTGGGCAGCCCAAGGAGAAGGAGGAGCCGTCCTCCATGGCGGACGTGTACAACCACGAGCTGACGCCGCT
GCAGAAGCACGTCGCCTTCTTCGACCGGAACAAGGACGGCGTCATCCACCCCTCCGAGACCTACGAGGGGTTCCGCGCGATCGGGTGCGGCGTCGCGCTG
TCCGCCTTCAGCGCCGTCTTCATCAACGGACTGCTCGGTCCCAAGACCATACCGGAGAACATGAAGGTTGGTGCTTTCAAGTTTCCGATCTACGTAAAGA
ACATCCACAAGGGCAAGCATGGGAGCGATTCGGGCGTGTACGATGCCAATGGAAGGTTTGTTCCTGAAAAGTTTGAAGAGATATTCAAAAAGCATGCTCA
CACCAGGCCTGATGCCCTGACAGGCAAAGAACTGAATGAGTTGCTTCAAGCAAACAGGGAGCCGAACGATTTGAAAGGACGAGTGGGTGGCTTCACAGAG
TGGAAGGTTCTCTACTCGCTGTGCAAAGATAAGGAGGGATTTCTTCACAAGGAGACCGTCAGGGCGGTCTACGATGGCAGCCTGTTTGTGAAGTTGGAGC
AAGAGAGGAAGCAAGCTAAAGAATCTGCCAAGAAGAAATGATGAAAACTATCCCAATACCCTCTTATTTGTGATTATGCGCAAGTATGCGTAAATTATGG
TGTGCTTGCGAGTATGGTTCTGTAAATTAATGTTGTGATTTGATTTCGTGTGTTTGCTTGTTCTTTTATGGAATGAGAATTCAAAGCCTGTTGTCTAGAT
ATCGCATTG
page-top