Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2295
Contig Information
Length 1410 bp
Tissue Root of dessiccated seed
Clones 5 Clones [Download: CSV  ,  FASTA ]
whrd10e10    rwhrd10e10    rwhrd1g07    rwhrd13m02    rwhrd20k13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phenylalanine ammonia-lyase >gi|1483610|emb|CAA68036.1| phenylalanine ammonia-lyase [Triticum aestivum]
Score 1943
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2295
AAAGATGGACCCAGTACATTTATCATGAAAATGTAACACACACTGCCTTTTTAACTTAGGTACATCATAAGAGTTCTACTGGCTACCCAACACTACCAAG
TCATGCAATTGCAATCTTTGGCAATACATTGGCAGCTCTAGAAGAACATTGTAAATATCAACTTTCAGAATATACAATGAAAAAACAGTATTATCATCAG
AGCCTTCAGAAATCTGAAGCACACTACTCTTCACTTTCTCGATCCTCTATTTAGCAGAGAGGCAAGGGCTCACCGTTCCACTCCTTGAGGCACTCAAGCA
GCGCATCGATGTGCTTGCCCTGGTTCATGGCAATGAACACCTTGTCCACCTCTTCGCCAGGAGACCGCGTCTTCTCTCCGGTCAAGTACTCCGTTCCAAG
CTCCTTGCGCACGAATCGGTAGAGTGGGTACGACCGGCATTCGGCAATACGGTTTTGCTGTGCGGCAGTGCCATTCTCCACGGCGCTCCTGGCAGCTTCA
ACCTCCTTTGGCAGCACCGCACGAAGCTCCTGCTCAAACGTGGCAAGCTTGGCAAACACTGACGTTTCCACGTCGCGCTCGGCCTCACCATTTGCCAAGG
CATGCTCCACAAGAACTGCACGCATCTTCTGCATCAGTGGGTAGTTGGCGCTACAAGGATCGTCTGCGTACGCAAACACCGCCTCACGGTCGATTGTGAG
CAGAAGGTCCTTCTCGCAGAAGCGCGCGTTATGGAGATGGCCATTGGTATCGGTGCTCAGTGTCTTCCTAGCTACAGTCTTCACACATCTCTTGATAGCA
TTCTTGACATTCTCCTCAAGGTGGCGGAGGTCGATAGCCTGGCACAACGCAACCAAGAACGTCGAGGACATGAGCTTGAGTATGTCAATGGCCTCGGCGG
TCTTCCTCGAGGAGATGAGACCAAGAGAGTTGACATCTTGGTTGTGCTGCTCCGCACTTTGGACATGGTTGGTCACAGGGTTGCCCAAGAACTGAAGCTC
GGAGCAGTAGGAGGCCATTGCAATCTCGGCACCCTTGAAGCCATAGTCCAAGCTTGGGTTGCGCCCACCAGAGAGGTTGGAAGGAAGACCGTTGTTGTAG
AAGTCGTTCACCAGCTCTGAGAATTGAGCAAACATGAGCTTGCCAATCGCAGCAATGGCAAGCCTGGTGTTGTCCATGGACACACCGATGGGTGTGCCCT
GGAAGTTGCCACCATGGATAGCTTTGCCACGGGAGACGTCGATGAGTGGGTTGTCGTTGACGGAGTTGATTTCCCGCTCAATCGACTTGGTGGCAGCACG
GATAACCTCAATCTGAGGGCCAAGCCACTGCGGTGATGTGCGGAGGGCATACCTATCTTGCTTTGGCTTCATCAATGGGTCAAGCTCACCGAGCTTCTTC
GCGAGCATCA
page-top