Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2294
Contig Information
Length 1794 bp
Tissue Root of dessiccated seed
Clones 5 Clones [Download: CSV  ,  FASTA ]
whrd10e02    whrd1i07    rwhrd10e02    rwhrd1i07    rwhrd16c13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit respiratory burst oxidase-like protein J [Hordeum vulgare subsp. vulgare]
Score 928
Evalue 8.03781e-98
Total Hit Count 474
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2294
AGCTCGGCTCACCCCGCCCTTCTCATCCGGACCTAGGGTTTGTGCGACCCTGCGAGCTCCGTCCCCGCTCTCCCCGCTCCACCCAGTCGCGGGCGTACCA
GCCGCCTCCCCGAGCCGTTCGAGCACAGGCCTCCTCGCAGAGGCACCTGTTGCCGCCCCCGCCGCCGCCAAGCACGAGGCTGTTTCTAGCTAAATCCAAG
GAATTGGTGCAATATCAGGTCATGGAGGGGAGTAAGAACATGCAAGAGTCAGACACTGCATCTGTTGTCAAAGTATCCAGGGAGCCTGTTATCATTATCA
ATGGTGTCCCAGACTTGCCTCCTGATTTCGCATCTGGTTCACAACCTGCAGTAAGAGACGCTCAAGGATCTCGAGTTGATCATCGCTTTGGTGAATGGCT
AGAAGGGCGGAAAGTGAGAAAGCAGTTTGGGGACAAGTATTTTGCAGGGAAAGTTGTCAAGTATGACAGTGAAAGCAATTGGTACAGTGTTGTCTATGAT
GATGGAGACCAGGAAGATCTTGAATGGCTTGAACTGGAGGAGATCCTGCTACCATTGGACATAACCATTCCACTCAGAAAACTTGTTATGGACAAATTCA
AACATCAGAATGCTGTTCCTGACTCCAGACTTAAGGGGGCTAGATCATCGCAAGGAACTAATGGTGCTCGCAACCAGATGGTGGTTAGAGCAGTAAATGG
CCAACAGTCAAACAACCTACCACTACCAGGGTTGCTTCAGGCGTCCCCGTCAAATGCAGAGACTGTCAGGGCAGAAAGACTGAAGATGCAGACCTCCAAA
AGAAAAACTGAAGAGGTATATCAGCCTAAAAAAAGGGGCAGGCCTCGAAAGGATAGAACTATATCAGTATCAGGTGACATTGAACCTAAAAAAAGAGGCA
GACCTCCAAAAGAAAAGAACATATCTGGGGAGAGTAGTGTTCATAAGCGCAATGCAGAGACTGTCAGGGCAGAAAAACTGAAGAGAGAAAGCTTGCGTGT
TCGAGGGGCATAACCTAACAATCAATCTCACTGTTACAATACAGATATTTCTAAATATTCCAGTCTATGTATGCTGGTGACACTAGCTTTCAATGTACTT
TGTACAACCCAGCGCACAACAAAACCTTGTAAAGCTATATTTACTATTCGAGCGCTACCATATTTCTTTTCCTATACAAGTATATCTGCAAACTGTTTGA
AATTCTTCGGGTATGGCATTAGAAGTTTTCCTTGTGGAAATGGAACCTAGTTGTGGTTGTCTGGCTGAATTCTTTTGAAAGATCCTTGAGTTGTTTCGTG
AGTGTTGGAGATCCACAATAGAAAACACCTATACGAGAGTTCTTGTGGGCATTGGCCAAATCGGAGAACACTTTTCTCCAGTTAGGTCTTGCAAAATGTG
TCCGAATCTTGCTTCCGGAGACAATGTCAACACCATTTTTGGCATGCTGGAGTGACTGAACCATGGCAATCAGCGCTGACCTTGCGTCGCCTTCTTCATA
CACGCTGGTGAGGTAATTGTGCATCTCGATGACATTGCTTTGATCGTTGTCAGCAACTTCATTCATGACTCCTTTGAACCAGTCGAAGGATCCTTGCTCT
CTGGTAACCCAGTAGAAGTAAGCTCTTCCTGGCCCACTGTTCTTGAAGCTGCCTATCTCAGAACTGTGTATGCTTTCCACCTCATCATTGGACTTTATGT
TGTTCAAGAGATCTTTCAATATGCTGATGAAAGGAGTGGCGCCAATCCCAAGACCGATAAGCAAAAGAATGTCGTATTTCTTGNAATTTTGCGC
page-top