Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2245
Contig Information
Length 728 bp
Tissue Root of dessiccated seed
Clones 5 Clones [Download: CSV  ,  FASTA ]
whrd10f07    whrd17d15    whrd17d16    rwhrd17d15    rwhrd17d16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_018551 [Oryza sativa (japonica cultivar-group)]
Score 264
Evalue 2.02583e-21
Total Hit Count 234
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2245
GCAAAGCCTACAAGCTTAGCCACAGAACAGTAAGATCGATCAGTAGCAATGGCGCCCTCCAAGCTCGCCCTTTTCCTCGCCCTGAACCTGGCCCTCCTTG
CCGCGGCGCATGGCTGCGAGCCCTACTGCCCACCAGTCGTACCTACCCCACCGATCCTCCCACCGTCTGTGCCGTCGACTGGCGGGGGCAGCTGCTCGAT
CAACACGCTGAAGCTGGGCGTGTGCGCCAATGTGCTGAACCTGCTGAAGCTCAAGATCGGCGTGCCGGCAAATGAGGAGTGTTGCCCGCTCCTGGCTGGG
CTCGCTGACCTCGACGCGGCCGTGTGCCTCTGCACCGCCATCAACGCTAACATCCTTGGCATCAAGCTGAATGTCCCCATCGACATCGTCCTCCTCCTCA
ACCAGTGCGGCAAGAAGTGCCCCTCCGACTTCACGTGCCCCATCTGATCCATCCAACCATCGATGAATGTTATACATGCATAATCGTTGCATTCGTAACT
AGTTTGCATGCCATACGTACACACCAGACGTATATTTTCTATGTTTCAGTTCATGTACTATATGTCAGGCGTTTGCATGGGCTCCCTCGCTCGTGCATGC
ATGCTTGATAAGCTTGTGATTTATCAACGATCAGTGTATCCCGTTATGGTATCTAAATGCATGATTCATCCTCGTGCCGAATCGGCACGAGGATCAAACG
CGGCGGCGGCAGCAGCGGCAGCGCAAGA
page-top