Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2231
Contig Information
Length 982 bp
Tissue Root of dessiccated seed
Clones 4 Clones [Download: CSV  ,  FASTA ]
whrd7o10    whrd12l20    rwhrd7o10    rwhrd12l20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cysteine protease [Triticum aestivum]
Score 1138
Evalue 1.54977e-122
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2231
GTGCTGGTCGTTCAGCGCGTCCGGGGCGTTGGAGGGGGCCAACTACCTGGCCACGGGCAAGATGGAGGTGCTCTCCGAGCAGCAGCTGGTCGACTGCGAC
CATGAGTGCGACCCAGCAGAACCTGATTCATGCGATGCTGGATGCAACGGTGGGTTGATGACTTCAGCCTTCAGCTATCTGTTGAAATCTGGTGGCCTTG
AGAGAGAAAAGGATTACCCTTACACCGGGAAGGACGGTACCTGCAAATTTGAGAAGTCCAAGGTTGCTGCTTCAGTTCAAAACTTCAGCGTTGTCGCTGT
TGATGAAGAACAGATTGCTGCTAACCTTGTGAAATACGGACCGCTGGCCATCGGTATCAACGCCGCATACATGCAGACATACATTGGCGGAGTGTCATGC
CCATACATCTGCGGCAGGCACCTCGACCACGGCGTCCTCCTCGTTGGCTACGGGGCGTCCGGGTTCGCACCTTCCCGCTTCAAGGAGAAGCCCTACTGGA
TCATCAAGAACTCATGGGGCGAGAACTGGGGGGACAAGGGTTACTACAAGATCTGCAGGGGCTCCAACGTGCGCAACAAGTGCGGCGTCGACTCCATGGT
CTCCACGGTGTCCGCCATGCACGCCTCGAAGGAGGAGTAGGCTCTGTTCTGGTCTGATCGTCAGCCCTCGTGGAGTCGATCTTGGTTTCGGTGTATCGCT
AGAAAGAAACTTCAATAGTACCGTAGTAGTCGGCTAGGCTCCATCGTCGTTGTGGTATCAGCAGCGAAGATGCGAAGCCGCAACAGAAAATGCTTGCTGT
ATAACTTATGCATTTGCTAAATTTGCTACGCCATGCATGTCTGCCACACGCTATTTGGATGTGGCTAAAGAACTCCTGAATAATTCTGTACATAATATGT
ATTGTTTCCATCAGAATGGTGTTCCGTCTTTGTTGACTTTGCTTGCGAGGTACTTACTCTGTAATGTAAAGAAACTAGTGGA
page-top