Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2220
Contig Information
Length 672 bp
Tissue Root of dessiccated seed
Clones 4 Clones [Download: CSV  ,  FASTA ]
whrd10e08    whrd7p05    rwhrd10e08    rwhrd7p05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0284600 [Oryza sativa (japonica cultivar-group)] >gi|47847708|dbj|BAD21487.1| putative 60S ribosomal protein L27 [Oryza sativa Japonica Group] >gi|47848339|dbj|BAD22201.1| putative 60S ribosomal protein L27 [Oryza sativa Japonica Group] >gi|113536101|dbj|BAF08484.1| Os02g0284600 [Oryza sativa (japonica cultivar-group)] >gi|125538995|gb|EAY85390.1| hypothetical protein OsI_06769 [Oryza sativa Indica Group] >gi|125581675|gb|EAZ22606.1| hypothetical protein OsJ_006089 [Oryza sativa (japonica cultivar-group)] >gi|215768337|dbj|BAH00566.1| unnamed protein product [Oryza sativa Japonica Group]
Score 584
Evalue 1.34996e-58
Total Hit Count 351
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2220
CCCTCCCCCAACCCACCGGCGGCGGCGCAGCGCAGCTTGAGGAAGGAAGCGAAGATGGTGAAGTTCCTGAAGCCCGGCAAGGCGGTGATCCTGCTGCAGG
GCAGGTACGCGGGGAAGAAGGCGGTGATCGTGCGCGTGTTCGAGGAGGGCACCCGCGACCGCCCGTACGGGCACTGCCTCGTCGCCGGGCTGGCCAAGTA
CCCGAAGAAGGTGATCCGCAAGGACTCGGCCAAGAAGACGGCCAAGAAGTCCCGCGTCAAGGTGTTCCTCAAGCTCGTCAACTTCACCCATCTCATGCCC
ACCCGCTATACCCTCGACGTCGACCTCAAGGAGGTGGCCTCCGGCGCGCCCGACTCCCTCACCTCCAAGGACAAGAAGGTGGGCGCCGCCAAGGCCGCCA
AGGCCAAGCTCGAGGAGAGGTTCAAGACCGGCAAGAACAGGTGGTTCTTCACCAAGCTCCGCTTCTAGGCCGGCCGGCCGCGCCAGGGCGGTCTCTGCCG
TTATTACTACCCGAACCCTTTACATTTTTAGTTGCTTGTTATCGGTGACTGTTGCTGCGCTTAAGGTGTCCTGTTTTGGTATTGCCCATGAAGAAGACTC
TGTGTTTAGCTTGGATCTTATGAGATATGATGATGTTTCATGTGTTAAATCATGTGAAGAATAGATCTTTGT
page-top