Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2183
Contig Information
Length 1181 bp
Tissue Root of dessiccated seed
Clones 4 Clones [Download: CSV  ,  FASTA ]
whrd10e13    whrd9d19    rwhrd10e13    rwhrd9d19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glucosyl transferase [Sporobolus stapfianus]
Score 1182
Evalue 1.61787e-127
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2183
CTCGCTCGCTGCCCGCCGTCCACGCGCTCGTCCTCGACATGTTCTGCGTCGACGCCCAGGACGTCGCAGCCGAGCTCAAGCTGCCGGTCTACTACTCGTT
CGCCTCCGCTGCCGGCGACCTCGCCATCTTCCTCAACCTGCCGAGCAAGTTCGCCAGCAATACGGCCAAGGTAAAAGAGCTCGGCGACTCCATCATCACC
TTCCCGGGTGTTCCTCCTTTCAAGGCTTCGGAGCTGCCGTCCGAAGTTATCGCCGACGATGAAGCATTCGTGTACGTCTTACGCATGTTTCAGCGAATGG
CGGAGGCGAAAGGAATTCTTACAAATTCCTTCGACTCGCTGGAAAAGCCCGCACTGAGCGCTCTCAGCGAAGGACTTTGCGTCCCTGGTCGTGCGACGCC
GCCGGTCTACTGCATCGGGCCGTTGGTCTCCGGAGGCGGAGACAAGGAGCACGAGTGCCTCCGCTGGCTGGACGCGCAGCCGGACCAGAGCGTGGTGTTC
CTCTCCTTCGGCAGCCTGGGCACATTCACCAGTAAGCAGCTCGAGGAAATTGCAGTTGGTCTGGAGAAGTCAGGGGAGAGGTTCCTGTGGGTTGTGCGGA
GCCCGCGCAGTCCCGACGAGAAGCACGGCGATCCGCTGCCGGAGCCTGACCTCGACGCGCTCATGCCGGAAGGGTTCTTGGAGAGGACCAAGGACAGAGG
GCTCGTGGTCAAGTCTTGGGCGCCGCAGGTGGAGGTTCTGCGTCACAGGGCGACCGGCGCATTCATGACGCACTGCGGCTGGAACTCGACGCTGGAGGGC
ATCACGGCAGGGTTGCCGCTGCTGTGCTGGCCGCTGTACGCGGAGCAGAAGGTGAACAAGGTGCACATAGTGGAGGGAATGAAGCTCGGGGTGGAGATGA
GAGGCTACAATGAAAAGGTTGTTAAGGCCGAGGAGGTGGAGGAGAAGGTCAGATGGGTTATGGCGTCCGAGGGAGGAGGCAGGGCACTCAGGGTGCGGGT
AGCGGCAGCGAAGGATGCAGCGGCTGAGGCGCTCCAGGAAGGGGGCTCGTCCAACTTGGCGTTTGCCCAATTCCTAAAAGACGTGGATGTGAAGCTTGTA
AACCTACTTAATGCTGGATTTTCTTTTTAGAAACACACTGCAGACGCACAAAACCCAGAGGATATTCTTCCCATGCAGATG
page-top