Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2154
Contig Information
Length 348 bp
Tissue Root of dessiccated seed
Clones 4 Clones [Download: CSV  ,  FASTA ]
whrd10b06    whrd10b17    rwhrd10b06    rwhrd10b17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08839 [Oryza sativa Indica Group]
Score 131
Evalue 1.95819e-06
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2154
ACTGGATCCTCTTCTCCGTCACCTCCCTCGTCGTCAAGCTCGACCACCTCCAGCAGCGCGTCGACAAGCTCAAGAAGCGCGACGACTGATCCCCTCCTCC
CCGTCGCGTCCCGGCCCCGGCAGGCCGACGGTGCCGTTGCTCCGTCTTCTCCCGCGTTTATGTTCCTAGATACAAACCTGTGATGCATGCGTTCCGTGTT
CTTCTTCCTTTGTAGTGTGGATGTTTGAGATCGCGATCCGGATTTCGCTAGCGTTCTGTTATCACTTACCTGCTTCAGATCTAGTTCGAGTAAAATAGGT
CTTTATGCGATAAAGATCATCATGAACACTGTTCCTGCAAAAAAAAAA
page-top