Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2140
Contig Information
Length 761 bp
Tissue Root of dessiccated seed
Clones 4 Clones [Download: CSV  ,  FASTA ]
whrd10f16    whrd11e01    rwhrd10f16    rwhrd11e01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione transferase F3 [Triticum aestivum]
Score 939
Evalue 1.17842e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2140
GACCACTTTTTATTTCATTCACACCGGATAAACAATCTGAAAACACACACAACATATACGCCGACGTTGCAATCACTGCTCTGCCTTGTTCCCCAGCCCA
AAGTCCGGTGACATGAACTCCTTGACCTTCCTCGCCGCCGGCCTGGCCTTGAGCTCCTCCCACCACGCCTTGACATGCGGGCGCTCCTCCACCAGCGACG
CGTACTCCGTCTCCATGAAGTAGTGCATGAGCGGGAAGTGGCTGAGGTCGGCGAGGCTGACCGACTCCCCGGCGAGATACTTGGACGCCGACAACCGCGC
CTCGTACACCTCCAGCACCTTCCTCAGCTTGACAACGTTCTCGTCGACGATGGCCTGGTCGCGCGTGCCGCCGAGTAGCGGGACGAGGAGGCACTGGATC
GAGATGGCGCCCGCCACGGGGTGGTGCTGGTGGGCCTCCACCTCCAGCCACACGTCCACCATCGCCGCCGACTCCGGCGAGCCGTCGCCCACCAGCAGCT
CCGGCTTGTACTTGCGAAGCACGTGCCTCGCAATTGCGCGCGACTCGAAGAGGGTGAGGTCGCCGTCCTCGAGAACGGGGACCTGGCCGAAGGGGTTCTT
GGCGAGGAAGTCCGGCAGAAGGTGGTCACCGGCCTCGCGTTTCATGGGGATGAGCTCGTAGTCGACGCCTGCCTCCTCCAGGCACAGCAGGGGGCGTGCC
ACGAACGGCGAGACCGCCCACCCGTACACCTTGAGCGCCGGCGCCATCGACTATCGAGATA
page-top