Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2128
Contig Information
Length 482 bp
Tissue Root of dessiccated seed
Clones 4 Clones [Download: CSV  ,  FASTA ]
whrd10e01    whrd1n07    rwhrd10e01    rwhrd1n07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0680300 [Oryza sativa (japonica cultivar-group)] >gi|113612180|dbj|BAF22558.1| Os07g0680300 [Oryza sativa (japonica cultivar-group)] >gi|218200264|gb|EEC82691.1| hypothetical protein OsI_27348 [Oryza sativa Indica Group]
Score 242
Evalue 2.57077e-19
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2128
CCTCGTGCCGAATCGGCACGAGGGAGAGAGAGAGAAAAGCAGCGAGACGCGAATCAGCGGCGGCGATGGCTCTCCCGGCGTCCGGCTCCACCCTCTCCCG
CTTCCTCTCCTCCCGCCGCATCCAGCCCACGGACGTCACCGCCCTCGCCACCTGGGGCGTCTTCGCCGGCAGCGCCGCCATCTACCTCGTCCAGCCATTC
GACTGGATCAAGAAGACCTTCTTTGAGAAGCCCGAGCCAGAGGCATGAGTGTCATACATTGCAACTTTTGATGCGTACATTTTCAGGACGATTCTCTGAG
TTTGGATGACCCAGCCAATAATATACAAGACCCTCGTGTTCCCTTGTTTGATTTGCCATCCAGATGTAGGTTTCCTCTTGCGTTGCATGTAACCCTCACC
ATGGGAGGGGAATGATCATGTAAATTTTATTTGCCGTCACAGAGAAAAGAAACTGTGCTCGTGTTTATTTCCAAAAAAAAAA
page-top