Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2120
Contig Information
Length 701 bp
Tissue Root of dessiccated seed
Clones 4 Clones [Download: CSV  ,  FASTA ]
whrd10f06    whrd10i01    rwhrd10f06    rwhrd10i01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 1.00737e-67
Total Hit Count 353
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2120
GCCGCAGCGGCGCGCACACCTCTCCCTCCTTCCTGAAGACAGCGCCGCCGCCGGCCAGAGCACAGGATGGCGACCGTCCCCGCTCCCGCAGCCGAGACCG
CGGCCTCCACGGCGCGCACCGTGAAGGATGTCAACCCCCACGAGTTCGTCAAGGCCTACTCCGCGCACCTCAAGCGCTCCGGCAAGATGGAGCTTCCAGA
GTGGGTTGACATTGTCAAGACTGCAAGGTTCAAGGAGCTGCCACCTTCTGATGCTGACTGGTACTACATCAGGGCTGCCTCCATGGCAAGGAAGATCTAC
CTGAGGCAGGGAATCGGGATCGGCGGCTTCCAGAAGATCTACGGTGGCCGTCAGAGGAACGGTTCACGCCCACCGCACTTCTGCAAGAGCAGCGGTGCTG
TTTCCCGCAACATCCTCCAGGAGTTGCAGAAGATGGGCATCATTGATGTCGACCCCAAGGGTGGAAGGCTCATCACCTCCCAGGGAAGGCGTGATCTGGA
CCAGGTTGCCGGAACTGTTCCTGCTGAATTCTGATCAGTTGAAGTCCCCTCTATGCAATCGTGTTTGGTAGTAGAATTTGGCTACAGTTTTGAATTATGA
TACCCACCCTGTGTTTGTTATGCAAGACTTTGTTGAAGTAGATCGCATGCTATCATGGTACAATGGTTATTGTCTGAGCTTTTAAATTATCTGCCCGCCA
G
page-top