Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2080
Contig Information
Length 1080 bp
Tissue Root of dessiccated seed
Clones 4 Clones [Download: CSV  ,  FASTA ]
whrd10h06    whrd18o07    rwhrd10h06    rwhrd18o07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 14-3-3 protein [Hordeum vulgare]
Score 1305
Evalue 7.73451e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2080
CAGCGGCGACACACGCAGACGCAGATTTGGCATTCAGAAAAAATTGAAATTGTGAACTGTGAAGATGACGGCACCAGCGGAGCTTTCCCGTGAGGAGAAT
GTGTACATGGCTAAGCTCGCCGAGCAGGCTGAGAGGTACGAGGAGATGGTTGAGTTCATGGAGAAGGTGGCCAAGACCGTCGACTCCGAGGAACTCACTG
TGGAGGAGCGCAACCTGCTCTCTGTTGCATACAAGAATGTGATTGGAGCCCGCCGTGCCTCATGGCGCATCATCTCCTCCATTGAGCAGAAGGAGGAGAG
CCGTGGCAACGAGGACCGGGTCACGCTCATCAAGGAGTACCGTGGCAAGATCGAGACTGAGCTTAGCAAGATCTGTGATGGCATCCTCAAGCTGCTCGAA
ACCCACCTTGTCCCGTCTTCCACTGCCCCTGAGTCCAAGGTCTTCTATCTTAAGATGAAGGGTGACTACTACAGATATCTTGCCGAATTCAAGAGTGGGC
CTGAGAGGAAGGATGCTGCTGAGAATACCATGGTGGCATACAAGGCTGCTCAGGATATTGCTTTGGCTGAGCTGGCTCCAACTCATCCGATTAGGCTTGG
GCTGGCACTGAACTTCTCGGTGTTCTATTATGAGATCCTCAACTCGCCTGATCGTGCTTGCAATCTCGCAAAGCAGGCATTCGATGAGGCCATTTCGGAG
CTGGACACCCTGAGCGAAGAATCCTACAAGGACAGCACCTTGATCATGCAACTCCTTCGTGATAACTTGACCCTCTGGACTTCTGACATCACGGAGGACA
CCGCGGAGGAGGAGATCAGGGAGGCTCCAAAGAACGACTCGAGCGAGGGGCAGTAAAGCCGGCTTTGCGACGCCCCGCAAGCTCCTAGCTAGTGTTTGCT
ACTGTCAATGACATTGCAATGTGGTCTGGATATGTCGTAGCCGTGTTATGGTTGTTGTCGCAAGATTTGAGGCTCCCCCGTATGTGATGTTGCCGGGGAA
GGTTGCTGTCGCCGCTTGTAGCGTAGCAGGCGGTGGCTGCCTCCTGGTCTGGCTCGGGAGGGAGCCCCATAGACTGGTGG
page-top