Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2014
Contig Information
Length 1579 bp
Tissue Root of dessiccated seed
Clones 4 Clones [Download: CSV  ,  FASTA ]
whrd10d22    whrd16h19    rwhrd10d22    rwhrd16h19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21277 [Oryza sativa Indica Group]
Score 1933
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2014
AAAGAATCCATCCGCACACTTGCTACTGATAAGTATAATGCTAATTACCAATAATACAGCCACTGGCCAAACATGCATTAACCAAAATGACAACCACAGC
AACCGTACTAATACTGCCCAGTATAATGCTAATTACCCTTTTATGAATCTAGAAGTACACATATTCGCGGACGGAGGGAGTATGTCTGTCTGTCCCTCTT
GCCAAGTCAACAACAACCAATCACCTCTTTCCTTGTGATAATTATTACTGCTTCACATCCACAGTCCAATCCAACGTGGATAGATTCAGGAAGGAAGGAT
CTATTGTATCATAGTCTGGACAGCTTGAGCTGCTGCTTGAGCAGCGGCCGGAGGTGCTCCTGGTACCCGTCGGGAACCACCGTCTCGTTCAGCGGGTCCT
TCCACGCCTCCTCGTACAGCGCCGGGTACACGTCCCCGTCGTACCGCCCCAGCACCGACCCCAGGTAGTGGTCCGTGTAGTCGAACGCGTCCACCAGCGC
CACCGCGTTAGGCCGCACCTGCGCGTACAGCTTCCCGAGCAGCTCGTTGGCCAGCGCGCCCTGCCTGGCTGTGACGCACCCCGTCGACAGGAAGTCGCCC
AGGTGCTTGTGGAGCAGGTGGAGCGCGTAGATGCTGCACAGGTTCTGCAGCTGCTCCTTCACCCCGGGGCCAGGGATGTCCTCCTGCAGCTTCTCGATGA
ACTTGGTCACAATGATCAGCTGGACGTGAGCCACAGCAGCCTCAAGCAAGTCGGGGGACAGCTCGGAGAAACCTTCTTCTTGGCTTGGCGCCTTGCTGAT
GTTCTGGGCACAGTTCACCGCCATCCTCAGGGCCCTAGCTTCAAACACCTCCTTTATGGCAGCAGGATTGAGCCAGTCTTCAGCTGTATTTACAGCGCTT
TTGCATTGCATCAAGTGTTGTATGTTGCCCATGTAAGCTATGGTGCCGACAGGTTGCTTCCCAGTGGCCACCTGAGCAACGGTCTTCATCAAAAACCTTG
CAACCTGCAAGAGCAAAACGACATTGTCTCCTTCATAGGTGCAGGCAGGAACATAGACCGCAAACAGTTCTGGAAGCCCACTGCTGTTCAGGTAACCATG
TCCGCCACAGAGCTTTCGGCACTCTTCAATCGCGTCAGCTGTTGCAGATGTTGTCACAGACTTGAGCCCAGCAGTACAGGCATGAGCCTCTGGCAGTGTT
GAGTAATCCTTAGCTTCCAGCTTCTGATTGACATCCGTGTATAGCCACTTCAACCACTGACCCACAAATCTATATGCATAAGCTGAAGCCAGCAAAGGGA
AGAGCCTGCTCTGTTGAGTCTTGTAATTGAGGACCTGAGTCTCAGGGCCACCATCTTGGGAACCGAACTGCTTCCGGATAGCACTATACCTTACAGCAAT
GCAAACAGCACGGGACAAAGCCTTGGAAGCATCTGCGACAATTGTCTGACGGACATAAACCATTGTCCCGTATAGCAGCTGCTTTGGTACATCTGAGTGC
ACATACTTTCCCTCCCTTGTAACTTGGGAAAGCCTCATCAACATTTGATCCCTTGGGATGCGCACATGGTCGAAGCGCA
page-top