Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1833
Contig Information
Length 809 bp
Tissue Root of dessiccated seed
Clones 3 Clones [Download: CSV  ,  FASTA ]
whrd10f09    whrd12i11    rwhrd12i11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L15 [Homo sapiens]
Score 625
Evalue 1.93346e-85
Total Hit Count 389
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1833
ATCGTATGCTGTGTGCTATGCTGTCATATGTTTGCTAAACCATTCTTTCTTCTGGTAACACAGGCAGATAGCAAATAGTTCAACAGATATTGCCTCGACA
TAAAGGTTCTAGCACGAGCTTCAAGGAGTTTCCGAACAAAGGTAGCAAAATCTGATGGTTCAAACGAATACTATCAAGGTGTGCATGGGGCAGCTTAACG
GTAGCGGCGGAGGGAGACGGTCTGGTTGCGCTTCCAGGTGGCTCTCCTCGAGGGCCTGTTCTTGTGGTGGCGGTGGCCCTTGCCACGCAGACCACGGAAT
TTCTTTCCGGCTGACGTGAGTCCGCGAAGCTCACGGTGCTTGTGCACAGGCTTGCAGAGCCAGTTGATCCTTGGGTCGTTGCGGACAGCACTGTGAGCAA
CATCAACAAGGATGACCTCAAAGTACTTGTAGGTAGAGTCCTCATTCACCCAGTAGGAGTTGAGCACACGAAGACCACCCAGCCTGCGCCCAGCTCTTTC
TTCAGCAACAGACCTCTTGTTCCTCTGGAACTTGAGCTGGGTAATACCCTGGTGCTTGGGCTTACCATAGACAATACCCTTGGGCACTGGCCTCTTCCTG
CCACCACGCCTGACACGGATACGGTAGACCACATACCCCTGCTTGGCCTTGAAGCCGAGACGGCGTGCCCTGTCGGGGGCGGGTGGGCCTGGTGATGCGC
ACGATGGCCGGCTGCTGCCTGTACTCCCAGCAACGCACGCGCTGCACGAACCTCATCACGTCCGACTGCTTCCTCCTCCATAGCTCCGACACGAACTTGT
ACGCGCCCA
page-top