Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1823
Contig Information
Length 728 bp
Tissue Root of dessiccated seed
Clones 3 Clones [Download: CSV  ,  FASTA ]
whrd10c02    whrd2p05    whrd4k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08713 [Oryza sativa Indica Group]
Score 949
Evalue 7.52168e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1823
CCCCTCTCTCTCTCTCACCGCAAGACCGGAAGGAGCGGAGCCGCCGAGCCGGGAAGAGCCACCATCCCATCGCCTCCGTTTCCGAAGGGTCAGAGATGGC
GGACCGTGCTAACCACCCGTCTGTCATGCAGAAGTTTGGTGGACAGTTCCACCTTGCCTCCAGCTTCTCTGAGGGTGTTCGTGCTCGCAACATCTGCCCT
TCTGTGCCATCCTATGAGAGGCGCTTCACCACAAGCAGCTACATGACTCAGAACCTTGGCATCAGTGTCCCAATGATGTCATCTTCTCCATTGTTTGCCA
ATGCACCCCCTGAGAAGAAAGGTGTCAAGAACTTTGCGATTGACTTCCTCATGGGAGGAGTGTCAGCTGCAGTTTCCAAGACTGCTGCAGCTCCTATTGA
GCGTGTTAAGCTGCTTATCCAGAACCAGGATGAGATGATCAAGGCTGGCAGGCTCTCTGAGCCATACAAGGGTATTGGTGACTGCTTTGGGCGCACCATC
AAGGATGAAGGCTTTGGCTCACTGTGGAGAGGAAACACTGCTAACGTCATCCGTTACTTCCCAACTCAGGCTTTGAACTTTGCATTCAAGGATTACTTCA
AGAGGATGTTCAACTTCAAGAAGGACAAGGATGGTTACTGGAAGTGGTTCGGTGGCAACCTTGCTTCTGGTGGTGCAGCTGGTGCTTCCTCGCTGTTCTT
CGTGTACTCCCTTGACTATGCTAGGACA
page-top