Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1722
Contig Information
Length 733 bp
Tissue Root of dessiccated seed
Clones 3 Clones [Download: CSV  ,  FASTA ]
rwhrd1j24    rwhrd14f08    rwhrd17a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calnexin precursor [Zea mays]
Score 557
Evalue 2.18307e-55
Total Hit Count 467
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1722
AGGAAAGAAGATCACTTCTAGCTGATTCCGGACAGCACACAAACAACACAAGGCTTCACCGGCTCGTAGGTTCTAGCGCCTTAAAACTAGGGGTAGCAGC
AGAGGGCAGCAAGACTGTTCGATTATACACTCGAGGAGTTCACAAAAAGGCCAGGACCGAGACGTCCGAAATGTGAGCCTATGTCTCCCTTCGCGACCTT
CTGCGTGGCACCGTCGTGTCATCCTCTTTCTCCTCCTTGTCGCCGCTGCTTCCAGCGGCATCGGCTTCCGTGGCACTGGGCTTCTTGACCTCGGCAACGG
GCTTCACAGGTGCCACTGGCTTCTTGCCACCGAAAATGGTTCTGAAGAGTACAGTCACAAGGATGACAGCGACTGAGGCCAAGATCGAAATTGTAATGTT
GGGCTGCTTCTCTCCCTTCTCAATAATATCAATGATCTTTATCTTGTAAGGTTCCAAGAATGGAATGTCGGCGATTTTGTACAAAACACTGAAGATCTTC
TTCTGGAACTCAGAAAGGTCTTCTGAATCGGCTGCTGCAGCCTCCTCAGCCTTCTGCTTTTCCTTCTCAACATCAAACTTGGGTTTCCATGTCTTCTCCA
AGATGGCGGTGGCTACCTTCTCATCATCGGCGATAAGAATGTTGTCAAAAAGGATGCCATCCTGCATTGTCCAGATCTCAATTCCAATAGCGGCAATCGG
ATCAAAGTCAGGCTTGTCAAGCTCAAAGTATTC
page-top