Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1707
Contig Information
Length 437 bp
Tissue Root of dessiccated seed
Clones 3 Clones [Download: CSV  ,  FASTA ]
whrd19e23    rwhrd19e23    rwhrd19f12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays] >gi|195653093|gb|ACG46014.1| ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 180
Evalue 3.98641e-12
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1707
TTTTTTTTTTGTCGAAATGGGCAGCGTAAACCCAGAAGCAAGCAACAAAAACGTTGCTCAATGGAAAAAGACCAAGAGCAGAGTTGTTCAGACTTCTATA
GCAACAATTCCATCAACCAAAATAAACTTTTATATCAGCAACAGCAACAGAAATTCTGTCGCAATTAATTTGGGAAGGGGCACAAGAAACTGCTACAGGC
AATGGACATGAAACCCGAAGGAGGAACAGTGTCATAATCTGCATTTTATTTCATGCATTGTGATGCTACAAGGAGCAAAAGCTGTGGCGCATATCAAGGA
AGATGTCTTCAAGGAAGGGTTCTCTCATAGAGAGGAAGGGCTCCCAGTGCTTTACGCTCTGCTGCCTCCTTTTTCACCAGAGCCAGCATGTCGCTCAAAT
AGCTTTTGAATGGTGTCTGTAGTGCCCGGACGTCGTC
page-top