Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1680
Contig Information
Length 973 bp
Tissue Root of dessiccated seed
Clones 3 Clones [Download: CSV  ,  FASTA ]
whrd10g03    rwhrd10g03    rwhrd10g04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 20S proteasome beta 5 subunit [Triticum aestivum]
Score 1357
Evalue 6.15072e-148
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1680
ACATTGCCATAACAGATGCGTAAGGTGAACATCAGCAGGTCTCGGAGGAGAACACTCTAATGTCGAGGAGGAGACAAACAAGCCCCCAGCTCCATAAAAC
AAGGTGCTTCAACACAGTTCACGGAATTTCGTATGACATCAATCAGGTTGACGCAGAAGGGGCCTCGGCCATCTCTTGCTCGACAGGAGCCGCCTGGACT
GGGTAGTAGTGGTAGTGCAGCTCTCCAACATCATCTCCAGACAACTTCTTCCAGCCGTCAGGGCCAACATAGTAGACACTAACACAGCCACCACTAGCTC
CGTCACGGAATGTTGCGTGGTAAATAGCCCGCCGAGCTAACTCAGCAGCTTCCTCAACTGACATGTTGAATTTGTAACCCTCGTCCAAGATACCATAAGC
ATATAGAGAGCCAGAACCAACAGAGAATCGGCTTCCCTTGAGCCTTGCACCCTCGCTATCAACATAGTACAAGCCCGGACCAGTTTCATCAAATCCAGCA
ATCATGGTACCGATTGAAAGTCCCATCCCGCGGTATGAATAAAGGATATTAGCCAACGTCTTTGAAGAACCAGCAATGGAGATCCTCCGCTTGTTCGCGA
GCTCATGGAGCCGGCACTTGACCCCCAAGTTTCTATGCCAAAATTGGCAATCAGCAGCACCTCCAGCCATGGTTCCCAGCATGTAGGGATTAATCTCGAT
GATTTTCCTCACAGTTTGCGAAGATATGTAGCCGCCCATGCTGGCCCGGGAGTCGGCGGCGACGATGACGCCCTTGTCGAAGATGAAGGAGAGCGTGGTG
GTCCCCTTCTTGTTGTTCACCATCTCCTTGGTCGCCTTCTGGAACCCATCGAAGTCGTTGCAGGTGGGGAACTCGAGGGCGAGCTGGTCGGCGGCGTCGG
CGGAGAAGAGGCCGGCGAAGTCGTCGCTGCCGGCGGCGGCGGCGCCGAAGTGGTTCTCGAGGGCGGAGAGGTT
page-top