Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1622
Contig Information
Length 682 bp
Tissue Root of dessiccated seed
Clones 3 Clones [Download: CSV  ,  FASTA ]
whrd10c21    whrd3l04    whrd13d19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycosyltransferase family 47 [Triticum aestivum]
Score 593
Evalue 1.15776e-66
Total Hit Count 170
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1622
TGATTGTTCTTCAGCTCGGCCTCGGCGTAGGACAGGCCCTCCCCACCTTCCGCCGCCACCAAACGCTTCTTGGTGGGGCAAGGAATTGCCGGAAAAGCCT
CTTCCCTGCCCCCCGTTCTCTTCTTCTTTAACTAGCCTTGGCGATTGCCTAGCGGTTCAGAAGGGCGGAGCCGGACGGAGAAGTGCTGGGGATCGAGAGG
ATGATGGCGAGGCGGGTCTTGGTTGCCATTGCGGTTCTTGCGGCGGCGGCGGCGGCGCTGTTTGTTGCGGCGGAGGCCCAGCAGGCGGCGGCGCAGCAGG
GCCACCAGACAGAGAGGATCTCAGGGAGTGCTGGTGACGTGCTGGACGATGACCCTGTTGGGAGGCTCAAGGTGTTTATCTATGACCTCCCTGGAAAATA
CAACAAGAAGCTGCTGAAGAAAGACCCAAGGTGCCTGAACCACATGTTCGCCGCGGAGATCTTCATGCACCGGTTCCTGCTGTCGAGCGCGGTTCGGACC
ACTAATCCCGAGGAAGCGGATTGGTTCTACACACCTGTGTACCCGACATGCGACCTGACGCCTTCGGGTCTCCCCTTGCCCTTCAAGTCTCCGCGGATGA
TGCGCAGCGCGATCGAGCTGATCGCGACGAAAATGGCCTTACTGGAATAGATCGGAGGGGGCAGATCATTTCTTTGTCACGC
page-top