Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1486
Contig Information
Length 534 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10a06    rwhrd10a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L37 [Zea mays]
Score 439
Evalue 4.85855e-42
Total Hit Count 291
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1486
CCTCCCTCGGCGGCGGCGCAGGCGGCGCGGAGGCGACAGGCGAAGGCGAAATGACGAAGGGAACGGGCAGCTTCGGCAAGCGCCGGAACAAGACCCACAC
GCTGTGCATCCGCTGCGGCCGCCGCAGCTTCCACCTGCAGAAGAGCACCTGCTCCTCGTGCGGCTACCCCGCCGCCCGCATCCGCAAGTACAACTGGAGT
GTGAAGGCCATCAGGAGGAAGACCACCGGCACCGGGAGGATGAGGTACATGCGCCATGTGCCCAGGAGGTTCAAGAGCAACTTCAGAGAGGGAACTGAGG
CCGCACCAAGGAGCAAGGGAGCCTCTTCCAGCGGCAACTAGGCGTGACAGTCTCCATTTGTTGCCCTAAGCGAAGCCCTGATCATCAAACTTAGCTTTTT
TGTTGTTTTCTACTGGAACTCTTATGTTTCTATGTTGAGAGGCAGACTATATGATGCCTGGTTATGTTATTTGCACAATTGTCGTGGACGTTAATCCTTC
AGTTTTGAATGTTGAATTGTGTCGAAAAAAAAAA
page-top