Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig34
Contig Information
Length 635 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhfl53j23    whfl53j23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0661700 [Oryza sativa (japonica cultivar-group)] >gi|38175743|dbj|BAC22424.2| unknown protein [Oryza sativa Japonica Group] >gi|113612076|dbj|BAF22454.1| Os07g0661700 [Oryza sativa (japonica cultivar-group)] >gi|125559493|gb|EAZ05029.1| hypothetical protein OsI_27212 [Oryza sativa Indica Group] >gi|125601400|gb|EAZ40976.1| hypothetical protein OsJ_024459 [Oryza sativa (japonica cultivar-group)] >gi|215692858|dbj|BAG88278.1| unnamed protein product [Oryza sativa Japonica Group]
Score 238
Evalue 1.56322e-18
Total Hit Count 29
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig34
ccctcggtttcTCGAGTCATCGCTGTCTGGAACAGCCCATCCAGCTCATCCCACTTGTCAACTCCCCTCCGACTCCGAGGGCACGGGCGGCGAGCATGGC
GGCGGGGCCGGCGGAAGCCCTGAAATCCTTCGAGGAGAGAGCTTCCGATGCCGAGGCACGGTTAGCAAAGCTGGAAGCCCTGCTGCTGAACAAAGATGGC
GCATCCGAGGCAAGTTCATCTGCCATGAGAGATCTTGAGTCAAAGCTTGACGCAGCCACCAAAGAATGTCTTGCCGAGAAGGAACAGAACCGGAAGCTGA
CCGTGGAGAACGAGAAGCTCCAGTATCGTGTCTCCCATCTCATCCGAACAATCAAAGAGGCGGAGTCAAGATAGAGAAGCCTCTGATAAGCTGGATCCCG
TAAAACTAGTCCTATTTTGGCTTCGAGAGAGACGGTCATCTCGCAAATCTGTCTATGTGCTCGGTGTTGACGTCTGTTGGAGTTGGTTTGAACTTTTAAT
CTGTCATTCCAATGTTGATGAAATGTGTCTGGTACGTGTAAGCTTAGCAGTAATGCATTGATCAGatcgattattcgtgtcgacgaacattgagcagcgt
gttgctatcggtcgcagcgaaagagaagggaaaga
page-top