Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1411
Contig Information
Length 1267 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10a07    rwhrd10a07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein binding protein [Zea mays]
Score 269
Evalue 8.46629e-28
Total Hit Count 36
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1411
TTTGCTTCCGTTGCACTTAGCACGATTCTGGTCTTATTAATGTTGGGGGCGAGCACATGCTGCAGCGCACGGTGCTCCAGTTCTTTCATTCAGTCAAGTT
CTTTCATTCAGTCATGTTCTTTCATTCAGTCAAATTCAGTCAAATTTTCTGAAGCTAGCATCCTTTTTTACTACGTACATCCTTTTTTTGTTTTCAGCAA
CTATAGGTGCTACTACATCTCTCTTTTTTTTGCAGGGACCAGGGCCAGGAATTAAAAAACAAACAAAAGCAGGGGCCAGGAGTACATCTCAACTTTTACT
GTATTTCTTGCTGACAACTAGTGCAAGTACACATTCTGAATATTGAAATTATCTTCTGTTAGTTACTAGGATAGTGGTTCATCCTGCTTGTCTGATCTGT
GGAGGAGACCAAGGGCATCAACCTCCCCAACTTGAATTTGTGTTGTTGTTACTTGACATGTTTGTGTTCCTCATTTGGAGTCAGGTAAGACCTGTGATAC
TTTGGAGAGGGACTTGGTAGTATTATATGGGCAGTTTGGCCACATAGTTTGGCAACCTAGTTTGAGGAGAACAAGTTTGCATGCTGATAATCTTACCTAC
TTTGTGACAGATCAACATATAATTTCTTCTAGAATTTGAATGATGTGTGCTAAACTGCTAATAGTATACTAACCATACCTGGTTCAGCTATAGAGAACAA
GTTTTCATGCTGCTGATCTTACCTACTTCGTGACAGATCAACATATAATTTCTTCTGGACTTGGAATGATGTGTGCTAAACTGCTAATAGTATAATAATA
AAACATATAGTGCAGTCATTGATTTATCATTTATGTAACCTAATGTGTGATTCTTTTTGTCATTTTGTTAATCAGGCTGTGGCATGGGACACCTATCCTT
GTGGTCATCAGCATCCTGGCATACTTCTGCTTCTTGGAGCAATTGCTGGTTGCGCATAACGGCTTCGCCGCCCTGGCGATTTCGCTGCCCTTCTCATGCA
TCCTAGGCCTCTTCTCATCACTGACCACAACAAGCATGGGGGCGAGGATATGTGGATCTTCGCGGCGATCCAGTTCCTCTTCGTCGTGTTCTTCACAACT
CTGTTCTACAGATATCTGCATCTGCAGGCTGTGATTTCCATCATCCTGGCAACCTTACCATGACACTACTATTATTGGACCATTACACTCATCTCTACCT
GGAGAACAAATTCCTTAGTGCAAGTTACTGATTGAATTTACACTCATCTGCAGAGCGTGAGAAAAAT
page-top