Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1278
Contig Information
Length 908 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10f19    rwhrd10f19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 272
Evalue 3.57095e-22
Total Hit Count 111
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1278
AAGAGTTAGTGAGCTACTATTTCAATGTCTTCATGTTGAGGAAGAGGGCTGAGCAGAATAGGTTTGATCCAATGAATGTTGACAGTGATAATGATGAATG
GGAGGGAAGAGATGATGATGAATTTGCTGTGACAGAAAGGGCTGGTGAGGATTTGCTGCTCGAGTCTCTTACTGATCAAGATGATGGTGCATGCAATCAA
GTTCCCCTCCAAGGAAATATGCATGAAGAGTCTGGTGAGGAGGATGAGTTTGACTGTTCTAGTGGTGACAGGCAAGAAAATTGCTGTGTGGAGGGGAATG
TCATGGTGTCCCTTGTGGACAATAACCAGGAGGCAACCATTTTTGACACAGATGCTCAAGACGACTCGTGCACATCATTTGAGGCTCCGCATGTTTGTAC
CACGGATGGCACACCCACTGATATTGCTGGAGACCACTACCGGGATGTTGGCTTTGGTAGCGTTGCAGATCATGGATACTTTGGTGGCCACTGCGACCCG
AAAACATGGGATATTGGTTTCAGTAGCGTGTGGGAGAAAGACGAATTTCTTTCGACAAACAATGTGATAGAAGAGGTGTTTGGAAAGGGTTCTTGTGAAA
ATGGAAATGACTCTTCTACTGCCCAGGGCATCATGTAAAGATGATCCGGGTTTCTGATGGAGAGCGAAGGCCGAACCTGCTTTTGAAATTTGTACAGTGG
TAGCTCTTCCTTTTTTTGATGATGATTCACTTGCCTGTAGAAATCCCGCCTCTGTCTGTCCCGAGAACATCTGTTTGAGAAATGTAATTTCATTCTCATG
ATGAATGTCTGTCTATTTGTAGTTATCCATCATCAGTCGATGATCTCCTGTAGCCTGTTGTAGCCTCTATGTACTGTTGTCATGACAAGTTTCAAGGCCT
GAGCATTT
page-top