Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig1024
Contig Information
Length 591 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10f15    rwhrd10f15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0185900 [Oryza sativa (japonica cultivar-group)] >gi|33146906|dbj|BAC79927.1| unknown protein [Oryza sativa Japonica Group] >gi|50508335|dbj|BAD30185.1| unknown protein [Oryza sativa Japonica Group] >gi|113610604|dbj|BAF20982.1| Os07g0185900 [Oryza sativa (japonica cultivar-group)] >gi|125557491|gb|EAZ03027.1| hypothetical protein OsI_25168 [Oryza sativa Indica Group] >gi|125599372|gb|EAZ38948.1| hypothetical protein OsJ_022431 [Oryza sativa (japonica cultivar-group)]
Score 189
Evalue 6.26043e-13
Total Hit Count 25
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig1024
CTCCACCCCTCCCATGGCCGCCCCCAGTTCCTGGGCCTCCCCGTTCCACGAAAAGAGAGCTTAGCGCTACCAAGCCCTCCGTTCTTTCCAGTTCTCGGCT
GCTTTCTCCGTCCCGGTCATCAATCTTCGTCGAGCAGAGAGAGGAAGGAGGTCGTCAGATTCGCGCGAGATCCATGGGGAAGTACGTGGAGCTGCTGGAT
ATGGGGGTGCGCATCGCCGCGCGGTTCCACTCCCACTGCCCTCAGACGGCCCGGATGTACTACCACCCTCCCGCTTCCTCCTCGGCCGCCCCCGGCGCCG
TCGACGGCGGCGGGATGGTGCCCGGAGAAGGCGCCGTGGCCATGGCCATGATGAAGAGGCAGCAGCGGGCCGCCATCGACGCCACGGAGATTATTCTCTA
CACCGTCGTCTAGGCCGGTTGCTTCTGAGCTCGTCCGGATTTATCGTGCCATTGAAGAGAGAGGAGAGGTGTTATCTTCTTTTATTGTACTTCTGTTTTA
CTTCCGAATCGAGAGAGGGAAATGAAAGATGGGAGACAATGTTTGATTGATTGAATGAACGGATTGAAGAATTTGCAAGTTAAAAAAAAAA
page-top