Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig644
Contig Information
Length 1246 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10a09    rwhrd10a09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 153
Evalue 3.63455e-08
Total Hit Count 34
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig644
ATAATTGGAAGCGCATCCCAAGTTCAAACTGCCCAGCAACTGATCCAGAATTTCATGGCGGAAGCCGCTCCACAAACCCGGCCGCCGGCTTCCAACCCTC
CTGCTCCGCCAGTCGACCCGGGTTACAGCTCTTACCCGCCACCACCATATGGGGCTCCTCCCACAGGTGCAGGAGGGCCTGCTCCTCACAATGGCGGAGG
CTACGGTGGCGGCTCCGGCTCCTACCATCCCAGCTACGGATACTAGCTTGTAACAGCAAGCTAAACGATTTGCTCCATCTCTATTGTGATGGTTGGTTTT
TTATCGTTGCCCAATAATTACAGTCATGGATTCCTGCCTATCAAATTAGTCAGTCTCGTGTATGGTTGGTGGTAGACTTTGGTAGTGTGTTTCCCGTCGT
GACATGTGGTTTATAGCTGAGCTACCTCATTGGATACAAAATACTTGTTGAGTTGAGTTGGAACAATTGTCCGAATTTGAAAGAGTGGACCAAACAAATT
GAATCGAACTTGGTAGCTACCATTCCCAGGTTATCCAATGTTGACGTTATATGTCTTCTCGGGCGGCCGCAGTCCACAAAATGGCCAGCCTGAACAGAAG
ATCCTCATAGCTCGAGCTCGAGCTTCAAAATGCCATCAAAATGGCCACCTGAGCGCCTGCCGTTCCTGTCCACCTGGGTCCCTAGTTTAATTATGTTAGC
ACAATCCTCTGAACTTTTAGGTTCTTGAATTATGTCTATGTTTAAGGTTGCTCCGTGTATTTGGAGCATGCAGTCCGTCGGCCTCAGGCCATGTATCCGC
TCTGCCCACTTTGCTTCTGCAAGTTGGTTGGCTGTTTCTTTTGCTCGTTGGTTGCTATCTGAATGTCAAGTGGCTTCATGCACTGTTATTTCTGCCTCGA
CGGCTTCTGCTGTTCCACAAAGCTCCAGGGTGCATCCGTTTCCATAATGCTAGAACAACCCATCAACTTTCTGAGTTGGAACGTGAGGAATGCCACGATC
GCCTCCTTGTCGTGTCTACAAGAGACGAAGCTTGACAACGTCGACCAATTCACAGCGGCTTTTTGGGTGGTCAGAGGCTACGTAGCTTTGCACAAAGACC
GGCAAACGGCACCAGGGGTGGAATTCTGCTGCTCTGGGATGATCTTCTAGTTGATGTTTCTTGCATCACCTATACAACATACTGCCTTTCCGCCATGATC
AGTGTGTGAGGGACCGGCATGCGCTTCGAGATCACCTCTAGATGAT
page-top