Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig625
Contig Information
Length 912 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10e22    rwhrd10e22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione transferase F3 [Triticum aestivum]
Score 936
Evalue 3.63213e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig625
GACGATGGCGCCGGCGCTGAAGGTCTACGGATGGGCGGTCTCACCGTTCGTGGCACGCGCGCTGATCTGCCTGGAGGAAGCAGGCGTCGACTACGAGCTC
GTCCCCATGAAACGTGAGGCCGGCGACCACCTCCTGCCGGACTTCCTCGCCAGGAACCCCTTCGGCCAGGTCCCCGTTCTCGAGGACGGCGACCTCACCC
TCTTCGAATCGCGCGCAATCGCGAGGCACGTGCTTCGCAAGTACCAGCCGGAGCTGCTGGTGGGCGACGGCTCGCCGGAGTCGGCGGCGATGGTGGACGT
GTGGCTGGAGGTGGAGGCCCACCAGTACAATCCCTCGGCTGGTGCCATCTCGATCCAGTGCCTCCTCGTCCCGTTCCTCGGCGGCACGCGCGATCAGGCC
ATCGTCGACGAGAACGTCGTCAAGCTGAGGAAGGTGCTGGAGGTGTACGAGGCGCGGCTGTCGGCGTCCAAGTACCTCGCCGGGGAGTCGGTCAGCCTCG
CCGACCTCAGCCACTTCCCGCTCATGCACTACTTCATGGAGACGGAGTACGCGTCGCTGGTCGAGGAGCGCCCGCATGTCAAGGCGTGGTGGGAGGAGCT
GAAGGCCAGGCCGGCGGCGAGGAAGGTCACGGAGTTCATGTCGCCGGACTTTGGGATGGTGAAGAAAGCAGAGCAGTGATTGCAACGCTGGCGTTTATTA
TGTTGTGTACACCTATGGCGCGATGTCTTTAGAATTTAGATTGTTTATTATGGGGCGTGTTACGCGTGGCCGACGAAAGATCCGTCGCTTGAATAATCTT
GCGGCCATGCTTCGTCGTTTACTTTTGCAACAAAAATCTTGTTATGAAACCTTTTGTAATAGAAATTGTGTGGTAGAAATATTTGTAACAAGTTGTGTTG
CAAAAAAATGCA
page-top