Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig438
Contig Information
Length 686 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10b03    rwhrd10b03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0134000 [Oryza sativa (japonica cultivar-group)] >gi|109940157|sp|P35686|RS20_ORYSJ RecName: Full=40S ribosomal protein S20 >gi|55296170|dbj|BAD67888.1| 40S subunit ribosomal protein [Oryza sativa Japonica Group] >gi|55297192|dbj|BAD68866.1| 40S subunit ribosomal protein [Oryza sativa Japonica Group] >gi|113594753|dbj|BAF18627.1| Os06g0134000 [Oryza sativa (japonica cultivar-group)] >gi|125553935|gb|EAY99540.1| hypothetical protein OsI_21509 [Oryza sativa Indica Group] >gi|125595951|gb|EAZ35731.1| hypothetical protein OsJ_019214 [Oryza sativa (japonica cultivar-group)] >gi|215692797|dbj|BAG88241.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215741311|dbj|BAG97806.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767736|dbj|BAG99964.1| unnamed protein product [Oryza sativa Japonica Group]
Score 587
Evalue 6.31755e-59
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig438
TCGCCCGCAGCGCCGCGGCCTCCTCCCTCCCATCCTCCCCACCGGCAGCCATGGCGACGGAGCTGGCCTACGCGCCGCCCATGAAGTCGGGCAAGCTCGG
GTTCGAGGGCACGCAGGAGGTGCAGCACCGCATCCGCATCACCCTCTCCTCCAAGTCCGTCAAGAACCTCGAGAAGGTGTGCTCGGATCTGGTGAAGGGC
GCCAAGGAGAAGCAGCTCAAGGTCAAGGGCCCCGTCAGGATGCCCACCAAGGTGCTCAACATCACCACCAGGAAGTCCCCCTGCGGAGAAGGGACCAACA
CCTGGGATCGGTTTGAGATGCGGGTGCACAAGAGGGTGATCGACCTTGTCAGCTCCCCAGACGTTGTCAAGCAGATCACCTCTATCACCATCGAGCCTGG
CGTCGAGGTCGAAGTGACCATCAGCGACCAGTAGTTATGCTACCCCAAGATATGTGTCTTTAAATCTTTTTACAAGGGTGGAGAGACACCTCCAACGTAC
CAAGATATTTTTGAAACTTTCTGTAGTATGAGAACTGGGTTTTGTATGACTAGGTTCTTTGCTTCGTGATTCTAAGTGCCTATCGTCCTAAGTTATCTTC
CGTCAATTTTCGTTGCCCCTGTTGTGTGTGCTGGAATGGATGTTTATACATGGATCGCTGTTGGACCTGTTTTCAGAAAAAAAAAA
page-top