Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig435
Contig Information
Length 674 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10d20    rwhrd10d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloride channel [Oryza sativa Japonica Group]
Score 569
Evalue 7.40746e-57
Total Hit Count 107
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig435
TTGGTTGGGCTTGTGATCAGGTCTCATCTATTGGTTTTGCTGAAAGGCAAGATGTTCATGAAGGAGCCAGTGAAAATGAGTGGTAGCTTTGTTATGGAAA
GATTTGGTGCCTTTGATTTTGCTAAGGCAGGGTCAGGGAAGGGTTTGAAAATTGAGGATCTATATTTCACTGATGAGGAGATGCAAATGTATGTGGATCT
CCATGCAATTGCAAACACCTCACCATATACGGTGGTTGAGACAATGTCACTAGCAAAAGCTGCACTCCTATTCCGAGAACTAGGATTGAGGCATCTCTTG
GTTGTTCCAAAGACCCCATACAGGCCTCCCATTGTTGGAATTCTCACAAGGCATGATTTTGTGGCGGAACATATCCACGACCTGTTCCCAAGTCTCAATC
CTCACAACTTTCATTCAGCCTCAATGGGAGGTTGATTGTGAATTTTTTTATGTTTCTTCCCATTCACAAAAATCATACGAGTCTTGTGTACATCAATCAG
ATTGCGCTTTTGTAATAATAATGTGGCAACATGGTTGGACGTCTGCCTAGTGCCAGAAGGTCAAGGAAGTGGGTGAACTGATGACAGGGAAGCCGGCAAC
CCTAGTTTTCTATTATGAGCCTATGACAGGAATCGTTGTGCCAACTGTAGACTAAACATTCAAAACCTTGGAAC
page-top