Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig418
Contig Information
Length 469 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10d12    rwhrd10d12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein SNOG_08190 [Phaeosphaeria nodorum SN15] >gi|111063346|gb|EAT84466.1| hypothetical protein SNOG_08190 [Phaeosphaeria nodorum SN15]
Score 274
Evalue 5.09564e-23
Total Hit Count 260
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig418
CCGCGCAAGTCCACACCGAACGACCGTCTCCCGTCGAACACACAATCTCACAAAATGGAAACCGCTAAGGCCCCCGTCAAGCTCGTCAAGGTCACTCGTG
TCCTTGGCCGAACCGGCTCCCGTGGTGGTGTCACCCAGTGCCGTGTCGAGTTCATGGACGACCAGACCCGTTCCATCATCCGCAACGTCAAGGGCGCTGT
CCGTGAGAACGACATTCTCTGCCTGCTCGAGTCCGAACGCGAGGCCCGCCGTCTGCGATAAACGCTTGCTTTGGGGAGAAGTGGCGCGTTGGCATTTTCC
TTCGGTTCCGGAGTTCTTCACGAATGGATCGGCTTTACACATGGTCATCATGAGGGCATGGATGCGTTAGTCTGGTGCCGCGAGGCGCTGTGAATGGAGA
GGATATGCGAGGAGACATGATAACCAGGAAATCAACGAACTGGGACTTGCTCCTGAATGAAAAAAAAAA
page-top