Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig294
Contig Information
Length 1069 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10d04    rwhrd10d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein Os03g30930 [Oryza sativa (japonica cultivar-group)] >gi|108708890|gb|ABF96685.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|108708891|gb|ABF96686.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|218193081|gb|EEC75508.1| hypothetical protein OsI_12109 [Oryza sativa Indica Group]
Score 817
Evalue 2.94703e-85
Total Hit Count 148
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig294
ACTCGTATCCGTTCTCGCCGTCCGCGTCGCCTACGTGCTTTGCCGCAGCGGCCTACCGCCGTCGAGGTCTCGTGCCTCCGGGCTGCGGTGTCTCATCGTC
CTCGGGTCTGGAGGGCATACTGCAGAGATGATGAATATTGTATCTGAGCTTCAGAAGGATCGCTTTACGCCTAGGTACTATGTGGCTGCACTTACTGATA
ACATGAGCCTTCCAAAGGCACAGGTCTATGAGAAGTCATTGATTCATGTGGAGGGTGATAGAGAAATGATCATCGAGAACGCCCAGTTCATGCAGATATA
TCGTAGCCGTGAAGTGGGCCAATCCTACATTACCTCCATCGCAACAACACTGCGTGCTACTTTGCATGCTATGTGGCTAATAATAAGAATCAGACCACAA
GTGATATTTTGCAATGGTCCCGGGACATGCATCCCTCTATGTGCTTCAGCTTTTCTTCTGAAGGTGCTTGGTCTGGGATGGTCCTCCATTTTCTACATTG
AAAGTATCGCAAGAGTGAAGAAGCTTTCGTTAAGTGGTTTACTGTTGTACAAGCTACGGATGGCCAATCAGTTCTTCGTGCAGTGGCCCCAGCTGCAACA
AAAATACCCTAGAGCACAATATGCTGGCCGTTTGATGTGATGATTCACCCTTAAATGATATTTGGGGACACCATCGTTTCCAACTCTGAAGATCTTGAAC
ATGCTGAGGTGCAGTTGAATACTTGAATTGACACACCCTACACGCCTGTTTCGCCAGAAACTTTTTTACTTGTTGGTATAGGCTTGCACCTTTCTTAGGA
TATATATATATGTATACTCATCAAAATTGTCTTTCAAGGCTGACCTATTGGCTGGGGAATGGAATGTTCCCTCTCAGATAGTCAGATATACCTTGTAGGC
TGTGACTCTGCAGAGTCAAGTGTAAACCTCATCCTGTAAGTTCCAGCCGCATTCTATTTGTCAGTGTTGTGTCGTTCGTTACATTTATCATGCCTCGTTG
CTGGCCTCAAACGTCACCAGAGGGAAAACTGCTGTTTTCTTTCCTTTTTGATAACCAGGGGAAGAATGC
page-top