Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig260
Contig Information
Length 314 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10c16    rwhrd10c16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09630 [Oryza sativa Indica Group]
Score 198
Evalue 3.2379e-14
Total Hit Count 253
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig260
ACGCCGCCGTCTGCCTCTGCACCGCCGTCAGGGCAAACGTACTCGGCATCCACCTCAACGTGCCTGTGGACATCAGCCTCCTCCTCAACCACTGCGGCAA
GACGTGCCCGTCCGAGTTCACTTGCCCGGCCCATTAACGGACGCGTACTGCTCACTGGCGCCGAATAAGATTTGCTTTCGATCCGTACTCCGTTGTTATT
TTTCGTGAGTTGTGGAACCGTTCCGCTTCCACATTTGAATCCTTGTAACCAGTACTACAACTATTGTTTTTGGCAAACAACCATGTGAATTGATATTGAG
ATATAAAAAAAAAA
page-top