Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig161
Contig Information
Length 490 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10c15    rwhrd10c15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit TaWIN2 [Triticum aestivum]
Score 95
Evalue 0.0290431
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig161
TGGGACTGGCTAGTTTTTACGTTGGATCGCCAAGCCTATCACAACCCTCCTCCTTTACCCGGGCTTGGGACCGGCTATGCCTAGAAGACATAGGCGGAGT
TGTAGTGTACTAACCAGTAACAAGGAAAAATGTTTACATAGCAGTAGACATTTTTTTAAAATAATGCTCAATAATTTATGTCAGCAGGATGACGCTGGCG
ATGAAATGAGGGATTCAAGCAAGCCTGAGGATGAGCAGTAGTGAAGGGTCCTAGCTACTGCCCTCTTTCTCTCTTAGCCTTCGGGTAGTTATGATGCTTG
TACAAGGACCATTTTCGTGTGTCCTTTGTTGCTGGGTCTTTTACCTACCCTTTCTTTCGTTATATTGTTATACATCGCCGTCCTCGTGCATTATTTTACT
TTACAACTTGAATCCTGCTCGTGTATGCACGGGTTCCTTAAGATTTGAACCAGAGGGTTCAACTCTTGCTTCCTATAATCAAAAAAAAAA
page-top