Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig100
Contig Information
Length 908 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10l16    rwhrd10l16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0176000 [Oryza sativa (japonica cultivar-group)] >gi|109892867|sp|P0C1G8|PSA4A_ORYSJ RecName: Full=Proteasome subunit alpha type-4-1; AltName: Full=20S proteasome alpha subunit C; AltName: Full=20S proteasome subunit alpha-3 >gi|8096319|dbj|BAA95822.1| putative proteasome subunit [Oryza sativa Japonica Group] >gi|8096329|dbj|BAA95832.1| putative proteasome subunit alpha type 4 [Oryza sativa Japonica Group] >gi|8671496|dbj|BAA96831.1| alpha 3 subunit of 20S proteasome [Oryza sativa Japonica Group] >gi|113594993|dbj|BAF18867.1| Os06g0176000 [Oryza sativa (japonica cultivar-group)] >gi|125596234|gb|EAZ36014.1| hypothetical protein OsJ_019497 [Oryza sativa (japonica cultivar-group)]
Score 1163
Evalue 1.71961e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig100
TCCCCCACCCGAACCCTCGGAATCCCTCCCTCGCCGCCGCCGACCCCTCCGCCGATCTCCCCGCCGCCGAGATGTCTCGCCGCTACGACAGCCGCACCAC
GATCTTCTCGCCGGAGGGCCGGCTGTACCAGGTGGAGTACGCGATGGAGGCGATCGGGAACGCCGGGTCGGCGCTCGGGATCCTGGCGGCCGACGGCGTC
GTCCTCGTCGGCGAGAAGAAGGTCACCTCCAAGCTGCTCCAGTCCTCCCGATCCGCGGAGAAGATGTACAAGATCGACTCCCACCTCGCCTGCGCCGTCG
CCGGGATCATGTCCGACGCCAACATCCTCATCAACACCGCCCGCCTCCACGCCCAGCGCTACGCGCTCTCCTACCAGGAGCCCATCCCCGTCGAGCAGCT
CGTCCAGTCCCTCTGCGACACCAAGCAGGGCTACACCCAGTTCGGGGGCCTCCGCCCCTTCGGCGTCTCCTTCCTCTTCGCGGGCTGGGACAAGAACCAC
GGCTTCCAGCTCTACATGAGCGACCCCTCCGGCAACTACGGCGGCTGGAAGGCCGCCGCCGTCGGGGCCAACAGCCAGGCCGCCCAGTCCATGCTCAAGC
AGGACTACAAGGACGGCATGACCCGCGAGGAGGCCGTCGCCCTTGCCCTCAAGGTCCTCAGCAAGACCATGGATTCCACTAGTTTGACTGCCGATAAGCT
GGAGCTGGCCGAGGTCTTCGTGCAGCCCGGCACTGGGGAGGTGCAGTACCAGGTGTGCTCTCCTGACGCCATGGGGAAGCTGCTTGCCAAGGCTGGGCTC
ACGCAGCCCGCGCCTGAGGCCTGATGTGCTGGTTTGCTGTGGCTTGTGATGCCTACTACTCTTAGACTGCTTAATCAGTTATGCTTCTGTTGTTTTAAGC
CAAACTAT
page-top