Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig99
Contig Information
Length 712 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11p02    whrd19b12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glyceraldehyde-3-phosphate dehydrogenase, cytosolic [Zea mays] >gi|195641440|gb|ACG40188.1| glyceraldehyde-3-phosphate dehydrogenase, cytosolic [Zea mays]
Score 760
Evalue 5.91698e-79
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig99
GCCAACCTCTGCCCCCTCCTCGGCTCCTCCTCCTCGTGACTCCCTCCTGCGGTCCCTCCCCGGTCAAACCCTAACGCGCACCCACCCACCCGTCCGTCCG
TCCGTCCGTTAATCCCTTCTCCCATGGCGGCGCTCTCCGTGCCTCTCCGCACCGCGGCGGCCCTGTCCTCGTCCGGCGCCGGATCCCGCGCCGTCGCCGA
CCCCTCCAAGGCGTCATGCGTGAGGAGCACTGGCTCCGCTCATTTTGGCTGCAGCTTCCCCTCCATTGTGGCTTCCTCGTCATCTGTCAGGAACATTGAG
CCACTTAGAGCTATAGCTACACAGGCACCACCAGCCGTCCCACAATATTCGAGTGGGGAGAAGACGAAGGTTGGCATCAATGGGTTCGGACGGATTGGGA
GATTGGTTCTGAGAATTGCAATCAGTAGAGATGATATTGAAGTTGTCGCTGTCAATGATCCTTTCATTGATGCTAAGTACATGGCTTATATGTTCAAGTA
CGACTCCACTCATGGCCCCTTTAAAGGATCCATTAATGTTGTGGATGATTCAACTCTGGAGATCAATGGGAAGAAAATCACGATAACAAGCAAAAGAGAC
CCAGCAGAGATTCCTTGGGGTAACTTTGGAGTTGACTATGTTGTTGAATCTTCTGGTGTTTTTACAACTATTGATAAAGCATCGGTTCACTTGAAAGGGT
GGTGCTAAGAAA
page-top