Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig98
Contig Information
Length 694 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11g10    rwhrd11g10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit thiosulfate transferase [Triticum aestivum]
Score 560
Evalue 8.672e-56
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig98
TCATCAAGTAGTTGATGCCCGAGCAAAGGGCAGATTTGATGGTGTAATGCCAGAACCAAGGGAAGGAGTAAGAAGTGGGCATATACCTGGAACTAAATGT
GTTCCGTTCCCTGAGATGTTTGATGGTGCACAAACGCTCCTCCCTGCAGATGAGCTATCGAAAAAGTTTGAGCAAGAAGGCATTTTGCTTGATCACCCGA
TTGTCGTCACATGTGGATCTGGTGTAACTGCCTGCATACTTGCCCTGGGCTTCTATAGAATTGGTAAGCATGATGTTCCAGTTTACGACGGATCTTGGAC
AGAATGGGAAGCGCAGCCCGATGATGATTACCCAAAAGTTGCTTCAACTGCCCCTTAAGTCAACCATTCTGTAGTGATGAATGCAGCTGTTGCATTCTGC
AGCATTCAACCCAGATTGTCAGCACAATGATACTTCTCTGTGGCAAGCTTTGCACGAAGTCGCCACAAAAGGTTATAGGGAAAAGAGAAATACCTTTTGT
ACAATGGCCAATGGCTGTAGGCCGATAATGGGGAAATCCTGCGCCAATTTTTGTGAGCGTCAACATTAATTTTATAATGATGTTGTACTTAACAAAATCT
TGACTTGAAAACAAGATTATTCGTCTGAATTGGTTATGTTTTGGAGTTGATTGTCTGAATTTATGAGACAATCTCACATCTGCCAAAAAAAAAA
page-top