Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig96
Contig Information
Length 848 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd12b17    rwhrd12b17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_019449 [Oryza sativa (japonica cultivar-group)]
Score 142
Evalue 3.77645e-07
Total Hit Count 186
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig96
GCAATCGACAGGGGTCAATGGGTCAGAAGCATTGGCGTTTCATTCATGAATCTGACATGCACATATAATCTGCATGGTGCTACTTAAAATTTATGAATGG
TTTATCGGCATGCTACTGGGATTTAGAGGCAGAAACGTCTTACTCCTGACTACATGGAGTTCTCAATAAATTATTCTTGTCATTTTTTTCGAGTCTATGC
TTCCTATCTCTGGGTCATCCGCCTCCCAAAGACTACTCCGAGGTAGAGCAAAGAAAACATCATCAGGTTTCAGGTGCACAAATTCAGCAGGTTTCAGTGC
CTTAGCATGCGATGTGGTGTCATGCCTGTTGTTTAACCCATATACTGGAACTGTTTATGGAAGTGGTTCTATGAACATGCTGATCGTGCTGCACTCATGC
TGACCATGGTTGCTTCATGTCCTCTCCTTTCATCGGCTGTTTGAGCTTCATCTGCGTATCTTAATGTTGCCTTTCCTCTGTACACCTCATCAAGACTGAA
CCAAGAGGTTGATGATTATGTTCTGGGTTGGCCATTGAGAGGGAGGCCGAAGCAAACTCCGTCAGGTTTCAGATAACTACTTCAGGTTAGGCGGGAGAAA
TAAAAAGGGTAACCATAGATATATGGTCTAGCATCACGAGGTTCAGGTTCCTGTTGTTGATCAACCGTTGCTTCGGTCGAGGTTCGCGGCGAGGATTGTT
GTGTCCAACCTGCACAAGAATGCCAAGAAGTCCTTCTCGGAGACGATTAAGGACATGTACCTGCACTACTACAACGAGAGATCTGGGCTGCTTCTTTATG
GCTTTCAAACTTAAAATGTTTATTTGGAAGTTAGTTTAGTTTTTTTGT
page-top