Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig94
Contig Information
Length 727 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11g17    rwhrd11g17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0605100 [Oryza sativa (japonica cultivar-group)] >gi|113596060|dbj|BAF19934.1| Os06g0605100 [Oryza sativa (japonica cultivar-group)]
Score 175
Evalue 4.19579e-11
Total Hit Count 84
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig94
CAGCCGGACGGCCATCACCTCGTCTTCTATAGCCATCCATCTCCACGATCCTTGATCCATTGGATTAATCCACCACTGGAAGCAGCAGCCTAGTCACCAT
TCCTACTCTGACATCCCCTCAACGTGAAGCTGGTGAGATACCAGTATCACAGGCTGAGCCCATGAATATAGAATCAGTTGTCATAGAGGAAGACAGCGAA
GAAGATGAAGCAAAAGCGGAAGAAAATGAAGCAGAAGAAGTAGTCGTTCGTCCTAGGAGGAAGTTGACATCTCCTGTTTGGAAGGAGTTTAAGAAAGTAA
AAGTGATGAACAGAATGAAGGCCAAGTGTAACTGGTGCTCAGAGAAGCTTGGAGGGGAACCAAGAAATGGAACGAAGCATCTCCTTGACCATTTAAAGAT
TGTACATGGAAAGAAGGTTTAGAGCGCATCACACTATAGAGGCGGTTCCTTCTGTACTTACTACAAGTCAGCTCAACTTCAACAAATAATGATGCCGAAC
ACATACCAAGGCTGTAGCTGTTAGCTTGCTACCTCTGCAATACTTTTGCGCATGATCATGTTTACCTTAAGTTAGTTATGGTCACATGGAACCTTATGTT
GGAGTCAATAAATTATGTCAAGTGAGCCAGACAAATTTCGTAGTCAATAAATTATGTCAAATGAGTCGGACAAAATTTTGTCCTTATTAAATGTGGTGTT
TGTATGAATACTCTCTTCAAGCGTGTG
page-top