Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig92
Contig Information
Length 622 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd12b05    rwhrd12b05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NADPH-dependent thioredoxin reductase isoform 2 [Hordeum vulgare subsp. vulgare]
Score 501
Evalue 4.67849e-49
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig92
TCAAGGTCAAGAACTTGGTGACTGGTGAGGTCTCTGACCTTAAGGTGTCCGGGCTCTTCTTCGCCATCGGGCATGAGCCGGCCACCAAGTTTCTCAATGG
GCAGCTTGAGCTCCATGCCGATGGGTATGTGGCCACCAAGCCGGGCTCTACACATACCAGTGTGGAGGGGGTCTTTGCTGCTGGAGATGTGCAGGATAAG
AAGTATCGTCAGGCCATTACTGCCGCTGGATCAGGGTGCATGGCTGCTTTGGACGCGGAGCACTATCTGCAGGAGGTGGGTGCACAGGAGGGCAAGTCTG
ATTGACTATCTCTTGGTGAAGCGACGACCATCAGCTCACCGAAAGCCGCACTCTGAGCTTGATGAAGTTGGTTGTCCAGTTTCATTATGCTGCTTAGCAG
CACCGTATTATTATTCTCCGTCATTAGGAGGCCCTAGATCAACTTTCATTAGTGTGCTGGAAATGATTCATATTTACCACTGGTGGAACTCAAACTGATT
CCTATGTATCATTGGCGAAATCACATTATTATTCTGAGATATCTATCTGTATTACTCCACCAGGTATGTATGCTATTATATTTTTCTACATGTTTGGAGC
ACCGCGTATTCTAAAAAAAAAA
page-top