Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig90
Contig Information
Length 890 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd12a14    rwhrd12a14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 23.5 kDa heat-shock protein [Triticum turgidum subsp. dicoccoides]
Score 1029
Evalue 5.72563e-110
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig90
GAGAGAGAGAGAAGAGAGAGACCATGGCTTCCGCCGTCGCTTCCAAGGGCAAGGTTCCCGTGCCGGCCAGCCTCCTCAAGTCCGGTGCTCCCGTGGCCTT
CTGCGCGCTCCAGTCCCCCGCCGTCACCGCCGCCCGCCGCCCGTACAACACCCAGTTCAAGGTCAAGGAGGTCAGCCGCTACGATGACGACGACGACGAC
TACAGCGGCCGCGACCTCGTCATCCCCAGCTTCTTCTCGCAGGACGTGCTCGACCCGCTCGGCGCGCCGACCAGCATGGAACGTCTGCTGTCTCTGATGG
AGGACGTCGCATCTCAGACCGGCCTCTCCTCCGCTGCTGGGGCGTCGCGGCTCGGACGCTGGGTGGCCAAGGAGGACGACGACGCGGTCTACCTCAAGGT
GCCGATGCCGGGGCTGACCAAGGAGCACGTGGAGGTGCGCGCGGACAAGAACATCCTGGTGATCAAAGGCGAGGGCGAGAAGCAGCCCTGGGACGGCGAC
GGCGACTCCGCAGTGCCGAGGTACAACCGCCGCATCGAGATGCCCGCCGACGCGTACAAGATGGACAAGATCAAGGCCGAGATGAAGAATGGCGTGCTCT
GGGTCACCCTGCTCAAGGTCAAGGAGGAGAAGCGCAAGGACGTCTTCCACGTCAAGGTCGAGTAGTCCTGGTGGTAGTGCTCATGGAGGATGGCCGGCGA
GAGTGTGAGAGACGCCTTGTTGATGTGGTGATGTTTGGTGTCTTTTCTTCCTTGTTTTGCTTCGTTGATTGTCTTGGATCCAGTAGGTGAAGTTGGCCGC
AAACTCTGTTAGTTTCCTCTAGTTCGGCATATGATGAACTTGCTTTGGTGATGAAATTGGTGATGAAATTCTGTTGATTTCTAAGTTGGC
page-top