Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig88
Contig Information
Length 396 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd10m14    rwhrd10m14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative acyl-CoA synthetase [Hordeum vulgare subsp. vulgare]
Score 253
Evalue 1.35685e-20
Total Hit Count 487
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig88
GGTGTTTTCCTCTTTGCCAGCTGAAAGGGTTCGAGTTCATAAGGGCCGTCCATCTTGACGCGGTGCCGTTCGACATGGAGCGCGAGCTCATCACCCCGAC
GTACAAGAAGAAACGGCCGCAGATGCTCAAGTACTACCAGGGAGCCATCGACGCGCTGTACAAGAGCTCAAAATAAGAGTGCGGGCACTCCGAACAACAG
CGAAAACGGCTTCTAGATCCTCGGAGCTTCCCGTCGAATCCTCGTGTGTGTGCGCGCGTGTGTATGTAAATTAATTAATATGCAAGACTTTGTTGTCAAT
GGTTGCTTACGTTTTTCACACAATGATGATATTCCCTCCGGGTTAATTAATACAAGACTTGTTGTTGAAGGCTGCCTACGTTTTTCAAAAAAAAAA
page-top