Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig85
Contig Information
Length 906 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd2e09    rwhrd2e09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cell wall invertase [Lolium perenne]
Score 1152
Evalue 3.22374e-124
Total Hit Count 465
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig85
TCGCGCACGACAACGCCAAGGGATGGGCCGGCATCCACGCGATCCCGAGGAAGATATGGCTGGACCCCAGCGGCAAGCAGCTGCTGCAGTGGCCCGTGGA
GGAGCTGGACCAGCTGAGGGGCAAGGCTGTCAGCGTGGGTGACAAGCTCGTCAAGCCCGGCCAGCACTTTGAGGTCACTGGCCTGCAGTCCTACCAGTCT
GACGTGGAGGTGAGCTTCGAGGTGTCGAGCCTGGACAAGGCGGAGCCGTTCGATCCGGCCTACGCCAACGACGCGCAGAAGCTCTGCGGGATGAAGAACG
CCGACGTCAAGGGCGGGGTGGGGCCCTTCGGCCTCTGGGTCCTGGCCTCTGACAACCTGGCCGAGAAGACCGCCGTGTTCTTCAGAGTCTTCAAGGATGG
GCATGGCAAGCCTCTCGTCCTCATGTGCAGTGACCCCACCAAGTCATCTCTCACCCCGGGTCTATACAAGCCGACTTTTGCCGGGTTTGTCGACACCGAC
ATTTCGTCCGGGAAGATCTCTCTGAGAAGCTTGATCGACCGATCGGTGGTTGAGAGCTTCGGCGCCGGAGGGAAGACCTGCATCCTATCGAGAGTGTACC
CATCCATGGCGATCGGGAAAGACGCACACCTTTATGTGTTCAACAACGGGGTGACCGATATCAAGGTGTCCAAACTAACGGCGTGGGAGATGAAAAAACC
AATGATGAATGGTGCCTAAGTAGTATATACCGTATATGTTTTCTCATGAGTTTAAGTTTTTGTTGAATGCCATTCGACATCGATGCACACCACGCAACTG
ATTGCTCGTCTTAATGAAGACCTCTTTGAGTAGAAGTGGTTAGAGAAATTTGTTGTACAATTGATAATTTCTGTCACGTGTTGTACGAATAAACCATGAT
GATCCC
page-top