Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig84
Contig Information
Length 540 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd11p20    rwhrd11p20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0419600 [Oryza sativa (japonica cultivar-group)] >gi|53982668|gb|AAV25647.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579124|dbj|BAF17487.1| Os05g0419600 [Oryza sativa (japonica cultivar-group)] >gi|125552373|gb|EAY98082.1| hypothetical protein OsI_20000 [Oryza sativa Indica Group] >gi|125594277|gb|EAZ34336.1| hypothetical protein OsJ_017819 [Oryza sativa (japonica cultivar-group)] >gi|215769439|dbj|BAH01668.1| unnamed protein product [Oryza sativa Japonica Group]
Score 302
Evalue 3.88392e-26
Total Hit Count 30
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig84
CTCCGATCCACCACCAACACGACACGAGCTCTTGGCGGAGGAGGAGCTGTCGGCAGCTTCGTCGTCGCGGTCGCCTCGTAGACGTAGGCGCGGGAAGAGA
GGCGGAGATGAGACGGCCGCTCGGCGCATGCGGCAGCAGATCCAGCCCGGCCGCTGCTTTCCTCCTGGCCGCCGCCGCGATCTGCGCCCAGTTCGCCACA
GGACTAGCTGATGATGCATCTAAAGACGAGTCAAAAGGTCACACTGGCCAAACAGTTTTGTTTGTCCTGCTAGGAATTGGTGTAGCCGGTCTGTTGTCAT
TCTTCCTTTTCAAGTATTGGCAGAAGAAGAAAAGAGAGGAGCAACATGCACGGCTGCTGAAGTTATTTGAAGAGGATGATGACATTGAGGTCGAGCTTGG
CCTTAGAGATTGATAATCTTCTCTGTACAGCAAAAGTATCTTGGCTGACAAGGTTTTGCTGGCAGATCATCCATCACCTTTGTGTTAATGTAAAGAATTT
GTTGTATTTAAACTCAGACAGCCTCCCGAGGAAGGTCTAC
page-top