Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig83
Contig Information
Length 759 bp
Tissue Root of dessiccated seed
Clones 2 Clones [Download: CSV  ,  FASTA ]
whrd2d18    rwhrd2d18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_026796 [Oryza sativa (japonica cultivar-group)]
Score 532
Evalue 1.82829e-52
Total Hit Count 376
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig83
CATTTTCTCAGAATGGGACTCGTGCAGTTTGTGTTCTCTCAGCAAATGGTTCCATATCAAATGTAACACTTCGTCAAACTGGTACATCAGGTGGAACTGT
AACATATGAGGGCCGATTTGAGATACTGTCACTCTCTGGGTCGATCTTTGTAACGGACAACGGAGGCCAGCGTACCCGAACAGGGGGGCTCAGCGTTTCG
CTGGCTGGTCCTGACGGTCGTCTCTTGGGTGGAGGGGTCGCAGGACTTCTCATAGCAGCTTCTCCAATCCAGATAGTAGTGGGAAGCTTCAATGCTTGTG
GGAAAAAAGAGCCAAAGCCGCAGGCTCCTTCTGAGCCCGTACCACTGAAGGTCGTTCCGAGCACTGGGATGGCGGCCAACAGCCCCCCTTCAAGAGGCAC
ATTGAGCGAATTGTCCGGTGGTACCGCAAGCCCGAGACATCAAGGCTACGCCTCCAACAACAATAACCAGCCGCCGATCTTGTCCAGCATGCCCTGGAAA
TGAACTCAGCATCCTTGACCGAATTCGGACATCGATAGACTGTCGGTGAACTGCCTCCCTGGCAGGAAGTAGAAATGTCATTCTGTCTAACTAGCTCCCA
TTTAGTCGTATAAATCAGAAGTTTAATTAGGGAGCAATGTAGCTGGTATGAGTGGTAACTGCAGCTGCTGTGTAGGTCGTCTCAGCTTGAATTTCTGTGC
CAGTTAGTTGTTTATTGTTGTCTTGAGATGATGTATTTAGGTATGATCTTGTGACCCTA
page-top